Parathyroid hormone related protein (PTHLH) (J03580) Human Untagged Clone

CAT#: SC312224

PTHLH (untagged)-Human, parathyroid-like protein (associated with humoral hypercalcemia of malignancy) mRNA, complete cds


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTHLH"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTHLH
Synonyms HHM; humoral hypercalcemia of malignancy; MGC14611; osteostatin; parathyroid; parathyroid-like protein; parathyroid hormone-like protein; parathyroid hormone-like related protein; parathyroid hormone-related protein; PLP; PTH-related protein; PTHR; PTHRP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for J03580, the custom clone sequence may differ by one or more nucleotides
ATGCAGCGGAGACTGGTTCAGCAGTGGAGCGTCGCGGTGTTCCTGCTGAGCTACGCGGTG
CCCTCCTGCGGGCGCTCGGTGGAGGGTCTCAGCCGCCGCCTCAAAAGAGCTGTGTCTGAA
CATCAGCTCCTCCATGACAAGGGGAAGTCCATCCAAGATTTACGGCGACGATTCTTCCTT
CACCATCTGATCGCAGAAATCCACACAGCTGAAATCCACCCCGTCCGATTTGGGTCTGAT
GATGAGGGCAGATACCTAACTCAGGAAACTAACAAGGTGGAGACGTACAAAGAGCAGCCG
CTCAAGACACCTGGGAAGAAAAAGAAAGGCAAGCCCGGGAAACGCAAGGAGCAGGAAAAG
AAAAAACGGCGAACTCGCTCTGCCTGGTTAGACTCTGGAGTGACTGGGAGTGGGCTAGAA
GGGGACCACCTGTCTGACACCTCCACAACGTCGCTGGAGCTCGATTCACGGAGGCAT
Restriction Sites Please inquire     
ACCN J03580
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq J03580.1, AAA60216.1
RefSeq Size 1887 bp
RefSeq ORF 1887 bp
Locus ID 5744
Cytogenetics 12p11.22
Domains Parathyroid
Protein Families Druggable Genome, Secreted Protein
Gene Summary 'The protein encoded by this gene is a member of the parathyroid hormone family. This hormone, via its receptor, PTHR1, regulates endochondral bone development and epithelial-mesenchymal interactions during the formation of the mammary glands and teeth. It is responsible for most cases of humoral hypercalcemia of malignancy, and mutations in this gene are associated with brachydactyly type E2 (BDE2). Alternatively spliced transcript variants have been found for this gene. There is also evidence for alternative translation initiation from non-AUG (CUG and GUG) start sites, downstream of the initiator AUG codon, resulting in nuclear forms of this hormone. [provided by RefSeq, Nov 2013]'

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.