PMS1 (BC008410) Human Untagged Clone

CAT#: SC312273

(untagged)-Human cDNA clone MGC:14544 IMAGE:4097623, complete cds

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PMS1
• Synonyms: HNPCC3|MLH2|PMSL1|hPMS1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for BC008410, the custom clone sequence may differ by one or more nucleotides
  ATGAAACAATTGCCTGCGGCAACAGTTCGACTCCTTTCAAGTTCTCAGATCATCACTTCG
  GTGGTCAGTGTTGTAAAAGAGCTTATTGAAAACTCCTTGGATGCTGGTGCCACAAGCGTA
  GATGTTAAACTGGAGAACTATGGATTTGATAAAATTGAGGTGCGAGATAACGGGGAGGGT
  ATCAAGGCTGTTGATGCACCTGTAATGGCAATGAAGTACTACACCTCAAAAATAAATAGT
  CATGAAGATCTTGAAAATTTGACAACTTACGGTTTTCGTGGAGAAGCCTTGGGGTCAATT
  TGTTGTATAGCTGAGGTTTTAATTACAACAAGAACGGCTGCTGATAATTTTAGCACCCAG
  TATGTTTTAGATGGCAGTGGCCACATACTTTCTCAGAAACCTTCACATCTTGGTCAAGGT
  AAGAAAGTAGCTTTGTATACAAACATTCTTTACCTTTTCTGTCTTAATTGTTGGTTTAAA
  AAAAAAAAAGTTACTCGG
  
• Restriction Sites: Please inquire
• ACCN: BC008410
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC008410.1
• RefSeq Size: 1906 bp
• RefSeq ORF: 1906 bp
• Locus ID: 5378
• Cytogenetics: 2q32.2
• Domains: HATPase_c
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]'