ST8SIA4 (NM_175052) Human Untagged Clone

CAT#: SC312288

ST8SIA4 (untagged)-Human ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ST8SIA4
• Synonyms: PST; PST1; SIAT8D; ST8SIA-IV
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_175052, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGCTCCATTAGGAAGAGGTGGACGATCTGCACAATAAGTCTGCTCCTGATCTTTTATAAGACAAAAG
  AAATAGCAAGAACTGAGGAGCACCAGGAGACGCAACTCATCGGAGATGGTGAATTGTCTTTGAGTCGGTC
  ACTTGTCAATAGCTCTGATAAAATCATTCGAAAGGCTGGCTCTTCAATCTTCCAGCACAATGTAGAAGGT
  TGGAAAATCAATTCCTCTTTGGTCCTAGAGATAAGGAAGAACATACTTCGTTTCTTAGATGCAGAACGAG
  ATGTGTCAGTGGTCAAGAGCAGTTTTAAGCCTGGTGATGTCATACACTATGTGCTTGACAGGCGCCGGAC
  ACTAAACATTTCTCATGATCTACATAGCCTCCTACCTGAAGTTTCACCAATGAAGAATCGCAGGTTTAAG
  ACCTGTGCAGTTGTTGGAAATTCTGGCATTCTGTTAGACAGTGAATGTGGAAAGGAGATTGACAGTCACA
  ATTTTGTAATAAGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_175052
• ORF Size: 507 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_175052.2, NP_778222.1
• RefSeq Size: 1906
• RefSeq ORF: 507
• Locus ID: 7903
• Gene Summary: The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks two exons and its transcription extends past a splice site that is used in variant 1, resulting in a shorter 3' coding region and a novel 3' UTR compared to variant 1. It encodes isoform b which is truncated at the C-terminus, compared to isoform a.