Aprataxin (APTX) (NM_175071) Human Untagged Clone
CAT#: SC312289
APTX (untagged)-Human aprataxin (APTX), transcript variant 5
"NM_175071" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | APTX |
Synonyms | AOA; AOA1; aprataxin; ataxia 1, early onset with hypoalbuminemia; AXA1; EAOH; EOAHA; FHA-HIT; FLJ20157; MGC1072; OTTHUMP00000021188 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_175071, the custom clone sequence may differ by one or more nucleotides
ATGCAGGACCCCAAAATGCAGGTTTACAAAGATGAGCAGGTGGTGGTGATAAAGGATAAATACCCAAAGG CCCGTTACCATTGGCTGGTCTTACCGTGGACCTCCATTTCCAGTCTGAAGGCTGTGGCCAGGGAACACCT TGAACTCCTTAAGCATATGCACACTGTGGGGGAAAAGGTGATTGTAGATTTTGCTGGGTCCAGCAAACTC CGCTTCCGATTGGGCTACCACGCCATTCCGAGTATGAGCCATGTACATCTTCATGTGATCAGCCAGGATT TTGATTCTCCTTGCCTTAAAAACAAAAAACATTGGAATTCTTTCAATACAGAATACTTCCTAGAATCACA AGCTGTGATCGAGATGGTACAAGAGGCTGGTAGAGTAACTGTCCGAGATGGGATGCCTGAGCTCTTGAAG CTGCCCCTTCGTTGTCATGAGTGCCAGCAGCTGCTGCCTTCCATTCCTCAGCTGAAAGAACATCTCAGGA AGCACTGGACACAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_175071 |
ORF Size | 507 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_175071.1, NP_778241.1 |
RefSeq Size | 1836 |
RefSeq ORF | 507 |
Locus ID | 54840 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the histidine triad (HIT) superfamily. The encoded protein may play a role in single-stranded DNA repair through its nucleotide-binding activity and its diadenosine polyphosphate hydrolase activity. Mutations in this gene have been associated with ataxia-ocular apraxia. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (5) contains multiple differences in the 5' UTR and coding region compared to variant 1. These differences result in translation initiation at a downstream in-frame ATG and an isoform (d) with a shorter N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224363 | APTX (Myc-DDK-tagged)-Human aprataxin (APTX), transcript variant 5 |
USD 420.00 |
|
RG224363 | APTX (GFP-tagged) - Human aprataxin (APTX), transcript variant 5 |
USD 460.00 |
|
RC224363L3 | Lenti ORF clone of Human aprataxin (APTX), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
RC224363L4 | Lenti ORF clone of Human aprataxin (APTX), transcript variant 5, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review