RIP3 (RIPK3) (BC041668) Human Untagged Clone

CAT#: SC312312

(untagged)-Homo sapiens, Similar to receptor-interacting serine-threonine kinase 3, clone MGC:47689 IMAGE:5767146, complete cds

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RIPK3
• Synonyms: RIP3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for BC041668, the custom clone sequence may differ by one or more nucleotides
  ATGTCGTGCGTCAAGTTATGGCCCAGCGGTGCCCCCGCCCCCTTGGTGTCCATCGAGGAA
  CTGGAGAACCAGGAGCTCGTCGGCAAAGGCGGGTTCGGCACAGTGTTCCGGGCGCAACAT
  AGGAAGTGGGGCTACGATGTGGCGGTCAAGATCGTAAACTCGAAGGCGATATCCAGGGAG
  GTCAAGGCCATGGCAAGTCTGGATAACGAATTCGTGCTGCGCCTAGAAGGGGTTATCGAG
  AAGGTGAACTGGGACCAAGATCCCAAGCCGGCTCTGGTGACTAAATTCATGGAGAACGGC
  TCCTTGTCGGGGCTGCTGCAGTCCCAGTGCCCTCGGCCCTGGCCGCTCCTTTGCCGCCTG
  CTGAAAGAAGTGGTGCTTGGGATGTTTTACCTGCACCGGGACCTCAAGCCATCCAACGTC
  CTGCTGGACCCAGAGCTGCACGTCAAGGTCAGCTGGTCTACACCCCTCTCAGCCTCAAGA
  CAAGGCCCCAGAGCTGCTCCAGCCAGGCCCGCCGGACAC
  
• Restriction Sites: Please inquire
• ACCN: BC041668
• ORF Size: 2662 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: BC041668.1
• RefSeq Size: 2662
• RefSeq ORF: 2662
• Locus ID: 11035
• Protein Families: Druggable Genome, Protein Kinase
• Protein Pathways: Cytosolic DNA-sensing pathway
• Gene Summary: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008]