SATB2 (AK025127) Human Untagged Clone

CAT#: SC312328

(untagged)-Human cDNA: FLJ21474 fis, clone COL04941


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SATB2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SATB2
Synonyms GLSS
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK025127, the custom clone sequence may differ by one or more nucleotides
ATGCATTTACCAAATATGAACCAGCTGGCATCCCTGGGGAAAACCAACGAACAGTCTCCT
CACAGCCAAATTCACCACAGTACTCCAATCCGAAACCAAGTGCCCGCATTACAGCCCATC
ATGAGCCCTGGTCTTCTTTCTCCCCAGCTTAGTCCACAACTTGTAAGGCAACAAATAGCC
ATGGCCCATCTGATAAACCAACAGATTGCCGTTAGCCGGCTCCTGGCTCACCAGCATCCT
CAAGCCATCAACCAGCAGTTCCTGAACCATCCACCCATCCCCAGAGCAGTTAAGCCAGAG
CCAACCAACTCTTCCGTGGAAGTCTCTCCAGATATCTACCAGCAAGTCAGAGATGAGCTG
AAGAGGGCCAGTGTGTCCCAAGCTGTCTTTGCAAGAGTGGCATTCAACCGCACACAGGTA
CAATTAGCATTAAACACTGTAATTAACAGTAATACTGGGGACAGAATTGAGATAGGTTAT
AATTATTTTTATCTCTTTAAAAAGCTTTATGGATCTCAGGACATAGAATTAGAT
Restriction Sites Please inquire     
ACCN AK025127
ORF Size 537 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AK025127.1, BAB15073.1
RefSeq Size 2306
RefSeq ORF 537
Locus ID 23314
Protein Families Transcription Factors
Gene Summary This gene encodes a DNA binding protein that specifically binds nuclear matrix attachment regions. The encoded protein is involved in transcription regulation and chromatin remodeling. Defects in this gene are associated with isolated cleft palate and cognitive disability. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Feb 2010]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.