SPFH2 (ERLIN2) (AK091697) Human Untagged Clone

CAT#: SC312333

(untagged)-Human cDNA FLJ34378 fis, clone FEBRA2018051

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ERLIN2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK091697, the custom clone sequence may differ by one or more nucleotides
  ATGGCCGTAGCTGGCCGCCAGGGATCGCCCGCGACTTGGTCGGTGCGGTCCTGGACCTCG
  GTCTTGGGTATCCGTCCTGGGGCTGGGGATGAGGGCGGTGTTGGTGGGAGCTCCCCGAGA
  GCGAGCGGCAGGACGCGCATGCCCCGGAGTACTGAGACCCAGGGCGAACCTTTCCAAGGC
  GTTGACTTTGGGGATTGCTCCGGATTTCCTTCTGCATTAGGCCGAACCTGGTTCGTTTTG
  GTTTTTTTAGAGACAAGGTCTCGCTCTTTTGCCCAGGCTGGAGTGCAGTGGCACGATCAT
  AGCTCACTACAGCCTCGAACTCCTGGGCTTAAGCGATCCTCCCACCTCACCCTGCTGAGT
  AGCTGGGACCACAGGCGCACGCCACGACACTTGACAATTTTATTTTTAGTAAAGACAGGG
  TCTTGGTATTTCTGGTCTCAAACTCTGGCTTCAAGCAATCCTCCTGCCTCGGCCTCCCAA
  ACTGCTGGGATTACAGGCATGAGCCACCATGCGCGGCCTTTTTTTTTTTTCTCTCCT
  
• Restriction Sites: Please inquire
• ACCN: AK091697
• ORF Size: 2088 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: AK091697.1
• RefSeq Size: 2088
• RefSeq ORF: 2088
• Locus ID: 11160
• Gene Summary: This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]