Parvin alpha (PARVA) (AK022316) Human Untagged Clone

CAT#: SC312349

(untagged)-Human cDNA FLJ12254 fis, clone MAMMA1001465


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PARVA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PARVA
Synonyms CH-ILKBP|MXRA2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK022316, the custom clone sequence may differ by one or more nucleotides
ATGGCCACCTCCCCGCAGAAGTCGCCTTCTGTCCCCAAGTCTCCCACTCCCAAGTCGCCC
CCGTCCCGCAAGAAAGATGATTCCTTCTTGGGGAAACTCGGAGGGACCCTGGCCCGGAGG
AAGAAAGCCAAGGAGGTGTCCGAGCTGCAGGAGGAGGGAATGAACGCCATCAACCTGCCC
CTCAGCCCAATTCCCTTTGAGCTGGACCCCGAGGACACGATGCTGGAGGAGAATGAGGTG
CGAACAATGGTGGATCCAAACTCACGCAGTGACCCCAAGCTTCAAGAACTGATGAAGGTA
TTAATTGACTGGATTAATGATGTGTTGGTTGGAGAAAGAATCATTGTGAAAGACCTAGCT
GAAGATTTGTATGATGGACAAGTCCTGCAGAAGCTTTTCGGTAGGAGAGTTGAGTGCTGC
AATGGATGTGTGTTTAATTGCAGGTGGTTGGATCACCTACTTGTAGCTAGAAGGAGTTAT
TCTCAGTTTACAGTGGCTTACCTGGAAATGGATTACAAATGTGTGGAGCATGGAATAACA
GCTCAG
Restriction Sites Please inquire     
ACCN AK022316
ORF Size 549 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AK022316.1, BAB14009.1
RefSeq Size 3347
RefSeq ORF 549
Locus ID 55742
Protein Pathways Focal adhesion
Gene Summary This gene encodes a member of the parvin family of actin-binding proteins. Parvins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. The encoded protein is part of the integrin-linked kinase signaling complex and plays a role in cell adhesion, motility and survival. [provided by RefSeq, Dec 2010]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.