RPAIN (AK098491) Human Untagged Clone

CAT#: SC312383

(untagged)-Human cDNA FLJ25625 fis, clone STM02974

SDS

Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug
Bulk Requests & Clone Modifications

Product Images

Other products for "RPAIN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPAIN
Synonyms HRIP|RIP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK098491, the custom clone sequence may differ by one or more nucleotides
ATGTGGAATCAGCAGGGTCATCCTGGCATCAGAAATCAGTTCTCTCTCTTTTTTTTTTTG
ACACAGAGTCTCGCTCTGTCACTCAGGCTGGAGTGCAGTGGCGCAATCTCGGATCACTGC
AACCTCCGCCTCCCGGGTTCAAGTGATTCTTCTGCCTCAGCCTCCCGAGTAGCTGGGATT
ATAGACGTGCGCCACATGCCTGGGCAACATGGTGAAACCCTGTCTCTACTAAAAATACAG
AAATTAGCTGGGTGTGGTGGCTCACACCTGTACTCCCAGCTACTCGGAAGGCTGAAGTGG
GAGGATGGCTTGAGCTCAGGAGGCAGAGGTTGCAGTGAGCTGAGAGGGCGCCATTGCGCT
CCAGGCTGGGTGACAGCGAGATTGTGCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAGA
GGAGGGGGAAAGACAAAATTGTATTCTATAGGTCTTGAGTTCAACATTTGGAAGGTAGAC
ATTTGGAATGCTCTAGTTCCACTAGACCTTTGGTTTTCACTTAAGGGGGAATCAAGGACC
ATTGTGTTAGAATCCAGTGAGGTCAGGACG
Restriction Sites Please inquire     
ACCN AK098491
ORF Size 573 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AK098491.1, BAC05317.1
RefSeq Size 1948
RefSeq ORF 573
Locus ID 84268
Gene Summary Mediates the import of RPA complex into the nucleus, possibly via some interaction with importin beta. Isoform 2 is sumoylated and mediates the localization of RPA complex into the PML body of the nucleus, thereby participating in RPA function in DNA metabolism. [UniProtKB/Swiss-Prot Function]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.