Dectin 1 (CLEC7A) (NM_022570) Human Untagged Clone

CAT#: SC312434

CLEC7A (untagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLEC7A
• Synonyms: BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_022570 edited
  ATGGAATATCATCCTGATTTAGAAAATTTGGATGAAGATGGATATACTCAATTACACTTC
  GACTCTCAAAGCAATACCAGGATAGCTGTTGTTTCAGAGAAAGGATCGTGTGCTGCATCT
  CCTCCTTGGCGCCTCATTGCTGTAATTTTGGGAATCCTATGCTTGGTAATACTGGTGATA
  GCTGTGGTCCTGGGTACCATGGGGGTTCTTTCCAGCCCTTGTCCTCCTAATTGGATTATA
  TATGAGAAGAGCTGTTATCTATTCAGCATGTCACTAAATTCCTGGGATGGAAGTAAAAGA
  CAATGCTGGCAACTGGGCTCTAATCTCCTAAAGATAGACAGCTCAAATGAATTGGGATTT
  ATAGTAAAACAAGTGTCTTCCCAACCTGATAATTCATTTTGGATAGGCCTTTCTCGGCCC
  CAGACTGAGGTACCATGGCTCTGGGAGGATGGATCAACATTCTCTTCTAACTTATTTCAG
  ATCAGAACCACAGCTACCCAAGAAAACCCATCTCCAAATTGTGTATGGATTCACGTGTCA
  GTCATTTATGACCAACTGTGTAGTGTGCCCTCATATAGTATTTGTGAGAAGAAGTTTTCA
  ATGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_022570
• ORF Size: 606 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_022570.3.

Reference Data

• RefSeq: NM_022570.3, NP_072092.2
• RefSeq Size: 2454
• RefSeq ORF: 606
• Locus ID: 64581
• Domains: CLECT
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. The encoded glycoprotein is a small type II membrane receptor with an extracellular C-type lectin-like domain fold and a cytoplasmic domain with an immunoreceptor tyrosine-based activation motif. It functions as a pattern-recognition receptor that recognizes a variety of beta-1,3-linked and beta-1,6-linked glucans from fungi and plants, and in this way plays a role in innate immune response. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1, resulting in a shorter protein (isoform b) compared to isoform a. Variant 2 has been alternatively referred to as variant 1 and isoform b has been alternatively referred to as beta in the literature.