G CSF (CSF3) (NM_000759) Human Untagged Clone
CAT#: SC312456
CSF3 (untagged)-Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 1
"NM_000759" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CSF3 |
| Synonyms | C17orf33; CSF3OS; GCSF |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_000759 edited
GCCCTTAATGGGGATTAAAGGCACCCAGTGTCCCCGAGAGGGCCTCAGGTGGTAGGGAAC AGCATGTCTCCTGAGCCCGCTTTGTCCCCAATGGCTGGACCTGCCACCCAGAGCCCCATG AAGCTGATGGCCCTGCAGCTGCTGCTGTGGCATAGTGCACTCTGGACAGTGCAGGAAGCC ACCCCCCTGGGCCCTGCCAGCTCCCTGCCCCAGAGCTTCCTGCTCAAGTGCTTAGAGCAA GTGAGGAAGATCCAGGGCGATGGCGCAGCGCTCCAGGAGAAGCTGGTGAGTGAGTGTGCC ACCTACAAGCTGTGCCACCCCGAGGAGCTGGTGCTGCTCGGACACTCTCTGGGCATCCCC TGGGCTCCCCTGAGCAGCTGCCCCAGCCAGGCCCTGCAGCTGGCAGGCTGCTTGAGCCAA CTCCATAGCGGCCTTTTCCTCTACCAGGGGCTCCTGCAGGCCCTGGAAGGGATCTCCCCC GAGTTGGGTCCCACCTTGGACACACTGCAGCTGGACGTCGCCGACTTTGCCACCACCATC TGGCAGCAGATGGAAGAACTGGGAATGGCCCCTGCCCTGCAGCCCACCCAGGGTGCCATG CCGGCCTTCGCCTCTGCTTTCCAGCGCCGGGCAGGAGGGGTCCTGGTTGCCTCCCATCTG CAGAGCTTCCTGGAGGTGTCGTACCGCGTTCTACGCCACCTTGCCCAGCCCTGAGCCAAG CCCTCCCCATCCCATGTATTTATCTCTATTTAATATTTATGTCTATTTAAGCCTCATATT TAAAGACAGGGAAGAGCAGAACGGA |
| Restriction Sites | Please inquire |
| ACCN | NM_000759 |
| Insert Size | 850 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | ORF was fully sequenced and matches with NM_000759.2. One SNP was observed in the ORF. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_000759.2, NP_000750.1 |
| RefSeq Size | 1518 bp |
| RefSeq ORF | 624 bp |
| Locus ID | 1440 |
| Cytogenetics | 17q21.1 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
| Protein Pathways | Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway |
| Gene Summary | 'This gene encodes a member of the IL-6 superfamily of cytokines. The encoded cytokine controls the production, differentiation, and function of granulocytes. Granulocytes are a type of white blood cell that are part of the innate immune response. A modified form of this protein is commonly administered to manage chemotherapy-induced neutropenia. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2020]' Transcript Variant: This variant (1) encodes the longest isoform (a). |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217237 | CSF3 (Myc-DDK-tagged)-Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 1 |
USD 450.00 |
|
| RG217237 | CSF3 (GFP-tagged) - Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 1 |
USD 460.00 |
|
| RC217237L1 | Lenti ORF clone of Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
| RC217237L2 | Lenti ORF clone of Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 1, mGFP tagged |
USD 768.00 |
|
| RC217237L3 | Lenti ORF clone of Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
| RC217237L4 | Lenti ORF clone of Human colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China