PGPEP1 (NM_017712) Human Untagged Clone

CAT#: SC312465

PGPEP1 (untagged)-Human pyroglutamyl-peptidase I (PGPEP1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PGPEP1
• Synonyms: PAP-I; Pcp; PGI; PGP; PGP-I; PGPI
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_017712 edited
  ATGGAGCAGCCGAGGAAGGCGGTGGTAGTGACGGGATTTGGCCCTTTTGGGGAACACACC
  GTGAACGCCAGTTGGATTGCAGTTCAGGAGCTAGAAAAGCTAGGCCTTGGCGACAGCGTG
  GACCTGCATGTGTACGAGATTCCGGTTGAGTACCAAACAGTCCAGAGACTCATCCCCGCC
  CTGTGGGAGAAGCACAGTCCACAGCTGGTGGTGCATGTGGGGGTGTCAGGCATGGCGACC
  ACAGTCACACTGGAGAAATGTGGACACAACAAGGGCTACAAGGGGCTGGACAACTGCCGC
  TTTTGCCCCGGCTCCCAGTGCTGCGTGGAGGACGGGCCTGAAAGCATTGACTCCATCATC
  GACATGGATGCTGTGTGCAAGCGAGTCACCACGTTGGGCCTGGATGTGTCGGTGACCATC
  TCGCAGGATGCCGGCAGATATCTCTGCGACTTTACCTACTACACCTCTTTGTACCAGAGT
  CACGGTCGATCAGCCTTCGTCCACGTGCCCCCACTGGGGAAGCCGTACAACGCGGACCAG
  CTGGGCAGGGCACTGAGAGCCATCATTGAGGAGATGTTGGACCTCCTGGAGCAGTCAGAG
  GGCAAAATCAACTATTGCCACAAACAC
  
• Restriction Sites: Please inquire
• ACCN: NM_017712
• ORF Size: 630 bp
• Insert Size: 650
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_017712.1, NP_060182.1
• RefSeq Size: 2239
• RefSeq ORF: 630
• Locus ID: 54858
• Protein Families: Druggable Genome, Protease
• Gene Summary: The gene encodes a cysteine protease and member of the peptidase C15 family of proteins. The encoded protein cleaves amino terminal pyroglutamate residues from protein substrates including thyrotropin-releasing hormone and other neuropeptides. Expression of this gene may be downregulated in colorectal cancer, while activity of the encoded protein may be negatively correlated with cancer progression in colorectal cancer patients. Activity of the encoded protease may also be altered in other disease states including in liver cirrhosis, which is associated with reduced protease activity, and in necrozoospermia, which is associated with elevated protease activity. [provided by RefSeq, Jul 2016]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.