CD89 (FCAR) (NM_133274) Human Untagged Clone

CAT#: SC312466

FCAR (untagged)-Human Fc fragment of IgA, receptor for (FCAR), transcript variant 6


  "NM_133274" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FCAR"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FCAR
Synonyms CD89; CTB-61M7.2; FcalphaRI
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_133274, the custom clone sequence may differ by one or more nucleotides
ATGGACCCCAAACAGACCACCCTCCTGTGTCTTGGGGACTTTCCCATGCCTTTCATATCT
GCCAAATCGAGTCCTGTGATTCCCTTGGATGGATCTGTGAAAATCCAGTGCCAGGCCATT
CGTGAAGCTTACCTGACCCAGCTGATGATCATAAAAAACTCCACGTACCGAGAGATAGGC
AGAAGACTGAAGTTTTGGAATGAGACTGATCCTGAGTTCGTCATTGACCACATGGACGCA
AACAAGGCAGGGCGCTATCAGTGCCAATATAGGATAGGGCACTACAGATTCCGGTACAGT
GACACCCTGGAGCTGGTAGTGACAGGCTTGTATGGCAAACCCTTCCTCTCTGCAGATCGG
GGTCTGGTGTTGATGCCAGGAGAGAATATTTCCCTCACGTGCAGCTCAGCACACATCCCA
TTTGATAGATTTTCACTGGCCAAGGAGGGAGAACTTTCTCTGCCACAGCACCAAAGTGGG
GAACACCCGGCCAACTTCTCTTTGGGTCCTGTGGACCTCAATGTCTCAGGGATCTACAGA
CTCCATCCACCAAGATTACACGACGCAGAACTTGATCCGCATGGCCGTGGCAGGACTGGT
CCTCGTGGCTCTCTTGGCCATACTGGT
Restriction Sites Please inquire     
ACCN NM_133274
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_133274.1, NP_579808.1
RefSeq Size 1561 bp
RefSeq ORF 630 bp
Locus ID 2204
Cytogenetics 19q13.42
Protein Families Transmembrane
Gene Summary 'This gene is a member of the immunoglobulin gene superfamily and encodes a receptor for the Fc region of IgA. The receptor is a transmembrane glycoprotein present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, where it mediates immunologic responses to pathogens. It interacts with IgA-opsonized targets and triggers several immunologic defense processes, including phagocytosis, antibody-dependent cell-mediated cytotoxicity, and stimulation of the release of inflammatory mediators. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (6, also known as U09) lacks an in-frame exon in the 5' coding region and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (f) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.