HEMK2 (N6AMT1) (NM_013240) Human Untagged Clone

CAT#: SC312484

N6AMT1 (untagged)-Human N-6 adenine-specific DNA methyltransferase 1 (putative) (N6AMT1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: N6AMT1
• Synonyms: C21orf127; HEMK2; m.HsaHemK2P; MTQ2; N6AMT; PRED28
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_013240, the custom clone sequence may differ by one or more nucleotides
  ATGGCAGGGGAGAACTTCGCTACGCCGTTCCACGGGCACGTGGGCCGCGGCGCCTTCAGC
  GACGTGTACGAGCCCGCGGAGGACACGTTTCTGCTTTTGAACGCGCTGGAGGCAGCGGCT
  GCCGAACTGGCAGGAGTGGAAATATGCCTGGAAGTAGGGTCAGGGTCTGGTGTAGTATCT
  GCATTCCTAGCCTCTATGATAGGCCCTCAGGCTTTGTACATGTGCACTGATATCAACCCT
  GAGGCAGCAGCTTGTACCCTAGAGACAGCACGCTGTAACAAAGTTCACATTCAACCAGTT
  ATTACAGATTTGGTCAAAGGCTTGCTACCAAGATTGACCGAAAAAGTTGATCTTCTGGTG
  TTTAATCCCCCCTATGTAGTGACTCCACCTCAAGAGGTAGGAAGTCACGGAATAGAGGCA
  GCTTGGGCTGGTGGCAAAAATGGTCGGGAAGTCATGGACAGGTTTTTTCCCCTGGTTCCA
  GATCTCCTTTCACCAAAAGGATTATTCTATTTAGTTACCATTAAAGAAAACAACCCAGAA
  GAAATTTTGAAAATAATGAAGACAAAAGGTCTGCAAGGAACCACTGCACTTTCCAGACAA
  GCAGGCCAAGAAACTCTTTCAGTCCTCAAGTTCACCAAGTCT
  
• Restriction Sites: Please inquire
• ACCN: NM_013240
• ORF Size: 645 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_013240.2, NP_037372.1
• RefSeq Size: 924
• RefSeq ORF: 645
• Locus ID: 29104
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes an N(6)-adenine-specific DNA methyltransferase. The encoded enzyme may be involved in the methylation of release factor I during translation termination. This enzyme is also involved in converting the arsenic metabolite monomethylarsonous acid to the less toxic dimethylarsonic acid. Alternative splicing pf this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (1) encodes the longer isoform (1).