CACNG6 (NM_145815) Human Untagged Clone

CAT#: SC312487

CACNG6 (untagged)-Human calcium channel, voltage-dependent, gamma subunit 6 (CACNG6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CACNG6
• Synonyms: 2310033H20Rik; AW050150; calcium channel, voltage-dependent, gamma subunit 6; MGC144251; MGC144252; voltage-dependent calcium channel gamma-6 subunit
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_145815, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGTGGTCCAACTTCTTCCTGCAAGAGGAGAACCGGCGGCGGGGGGCCGCGGGCCGGCGGCGGGCGC
  ACGGGCAGGGCAGGTCGGGGCTGACGCCCGAGCGCGAGGGGAAGGTGAAGCTGGCGCTGCTGCTGGCCGC
  CGTGGGCGCCACGCTGGCGGTGCTGTCCGTGGGCACCGAGTTCTGGGTGGAGCTCAACACCTACAAGGCC
  AACGGCAGCGCCGTGTGCGAAGCGGCCCACCTGGGGCTGTGGAAGGCGTGCACCAAGCGGCTGTGGCAGG
  CGGACGTGCCCGTGGACAGGGACACCTGCGGCCCCGCGGAGCTGCCCGGAGAAGCAAACTGCACCTATTT
  TAAATTCTTCACCACGGGGGAGAATGCACGCATCTTTCAGAGAACCACAAAGAAAGGCCTGCTGCTCTTG
  GTGAGCCTGGAGGTGTTCCGGCATTCCGTGAGGGCCCTGCTGCAGAGAGTCAGCCCGGAGCCTCCCCCGG
  CCCCACGCCTCACCTACGAGTACTCCTGGTCCCTGGGCTGCGGCGTGGGGGCCGGCCTGATCCTGCTGTT
  GGGGGCCGGCTGCTTTCTGCTGCTCACACTGCCTTCCTGGCCCTGGGGGTCCCTCTGTCCCAAGCGGGGG
  CACCGGGCCACCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_145815
• ORF Size: 645 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_145815.1, NP_665814.1
• RefSeq Size: 1748
• RefSeq ORF: 645
• Locus ID: 59285
• Protein Families: Druggable Genome, Ion Channels: Other, Transmembrane
• Protein Pathways: Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
• Gene Summary: Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is an integral membrane protein that is thought to stabilize the calcium channel in an inactive (closed) state. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). Alternative splicing results in multiple transcript variants. Variants in this gene have been associated with aspirin-intolerant asthma. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in a shorter isoform (b) with the same N- and C-termini as isoform a. This variant lacks publicly available transcript support but it is supported by RT-PCR data in PubMed ID:11170751. CCDS Note: This CCDS representation lacks publicly available transcript support. The represented exon combination is supported by RT-PCR data in PMID:11170751 and by RNA-Seq data from the ENCODE project.