CACNG6 (NM_145815) Human Untagged Clone

CAT#: SC312487

CACNG6 (untagged)-Human calcium channel, voltage-dependent, gamma subunit 6 (CACNG6), transcript variant 2


  "NM_145815" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CACNG6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CACNG6
Synonyms 2310033H20Rik; AW050150; calcium channel, voltage-dependent, gamma subunit 6; MGC144251; MGC144252; voltage-dependent calcium channel gamma-6 subunit
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_145815, the custom clone sequence may differ by one or more nucleotides


ATGATGTGGTCCAACTTCTTCCTGCAAGAGGAGAACCGGCGGCGGGGGGCCGCGGGCCGGCGGCGGGCGC
ACGGGCAGGGCAGGTCGGGGCTGACGCCCGAGCGCGAGGGGAAGGTGAAGCTGGCGCTGCTGCTGGCCGC
CGTGGGCGCCACGCTGGCGGTGCTGTCCGTGGGCACCGAGTTCTGGGTGGAGCTCAACACCTACAAGGCC
AACGGCAGCGCCGTGTGCGAAGCGGCCCACCTGGGGCTGTGGAAGGCGTGCACCAAGCGGCTGTGGCAGG
CGGACGTGCCCGTGGACAGGGACACCTGCGGCCCCGCGGAGCTGCCCGGAGAAGCAAACTGCACCTATTT
TAAATTCTTCACCACGGGGGAGAATGCACGCATCTTTCAGAGAACCACAAAGAAAGGCCTGCTGCTCTTG
GTGAGCCTGGAGGTGTTCCGGCATTCCGTGAGGGCCCTGCTGCAGAGAGTCAGCCCGGAGCCTCCCCCGG
CCCCACGCCTCACCTACGAGTACTCCTGGTCCCTGGGCTGCGGCGTGGGGGCCGGCCTGATCCTGCTGTT
GGGGGCCGGCTGCTTTCTGCTGCTCACACTGCCTTCCTGGCCCTGGGGGTCCCTCTGTCCCAAGCGGGGG
CACCGGGCCACCTAG


Restriction Sites SgfI-MluI     
ACCN NM_145815
ORF Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_145815.1, NP_665814.1
RefSeq Size 1748
RefSeq ORF 645
Locus ID 59285
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
Gene Summary Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is an integral membrane protein that is thought to stabilize the calcium channel in an inactive (closed) state. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). Alternative splicing results in multiple transcript variants. Variants in this gene have been associated with aspirin-intolerant asthma. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in a shorter isoform (b) with the same N- and C-termini as isoform a. This variant lacks publicly available transcript support but it is supported by RT-PCR data in PubMed ID:11170751. CCDS Note: This CCDS representation lacks publicly available transcript support. The represented exon combination is supported by RT-PCR data in PMID:11170751 and by RNA-Seq data from the ENCODE project.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.