Bcl 7A (BCL7A) (NM_020993) Human Untagged Clone

CAT#: SC312558

BCL7A (untagged)-Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BCL7A
• Synonyms: BCL7
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_020993 edited
  ATGTCGGGCAGGTCGGTTCGAGCCGAGACGAGGAGCCGGGCCAAAGATGATATCAAGAGG
  GTCATGGCGGCGATCGAGAAAGTGCGCAAATGGGAGAAGAAATGGGTGACCGTTGGTGAC
  ACATCCCTACGAATCTACAAATGGGTCCCTGTGACGGAGCCCAAGGTTGATGACAAAAAC
  AAGAATAAGAAAAAAGGCAAGGACGAGAAGTGTGGCTCAGAGGTGACCACTCCGGAGAAC
  AGTTCCTCCCCAGGGATGATGGACATGCATGACGATAACAGCAACCAGAGCTCCATCGCA
  GATGCCTCCCCCATCAAACAGGAGAACAGCAGCAACTCCAGCCCCGCTCCAGAGCCCAAC
  TCGGCTGTGCCCAGCGACGGCACCGAGGCCAAGGTGGATGAGGCCCAGGCTGATGGGAAG
  GAGCACCCAGGAGCTGAAGATGCTTCTGATGAGCAGAATTCACAGTCCTCGATGGAACAT
  TCGATGAACAGCTCAGAGAAAGTAGATCGGCAGCCGTCTGGAGACTCGGGTCTGGCCGCA
  GAGACGTCTGCAATCTCTCAGGTACCTCGCTCGAGGTCTCAGAGGGGCAGCCAGATCGGC
  CGGGAGCCCATTGGGTTGTCGGGGGATTTGGAAGGAGTGCCACCCTCTAAAAAGATGAAA
  CTGGAGGCCTCTCAACAAAACTCCGAAGAGATGTAG
  
• Restriction Sites: NotI-NotI
• ACCN: NM_020993
• ORF Size: 696 bp
• Insert Size: 2600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_020993.3. This SNP doesn't change amino acid.

Reference Data

• RefSeq: NM_020993.3, NP_066273.1
• RefSeq Size: 3714
• RefSeq ORF: 696
• Locus ID: 605
• Domains: BCL_N
• Protein Families: Druggable Genome
• Gene Summary: This gene is directly involved, with Myc and IgH, in a three-way gene translocation in a Burkitt lymphoma cell line. As a result of the gene translocation, the N-terminal region of the gene product is disrupted, which is thought to be related to the pathogenesis of a subset of high-grade B cell non-Hodgkin lymphoma. The N-terminal segment involved in the translocation includes the region that shares a strong sequence similarity with those of BCL7B and BCL7C. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.