Synaptogyrin 1 (SYNGR1) (NM_004711) Human Untagged Clone

CAT#: SC312566

SYNGR1 (untagged)-Human synaptogyrin 1 (SYNGR1), transcript variant 1a

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SYNGR1
• Synonyms: MGC1939
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_004711, the custom clone sequence may differ by one or more nucleotides
  ATGGAAGGGGGTGCGTACGGAGCGGGCAAAGCCGGGGGCGCCTTCGACCCCTACACCCTG
  GTCCGGCAGCCGCACACCATCCTGCGCGTCGTGTCTTGGCTGTTCTCCATAGTGGTGTTC
  GGCTCCATCGTGAACGAGGGCTACCTCAACAGCGCCTCCGAGGGGGAGGAGTTCTGCATC
  TACAACCGCAACCCCAACGCCTGCAGCTATGGCGTGGCCGTGGGCGTGCTCGCCTTCCTC
  ACCTGCCTGCTGTACCTGGCCCTGGACGTGTACTTCCCGCAGATCAGCAGCGTCAAGGAC
  CGCAAGAAAGCCGTCCTGTCCGACATCGGTGTCTCGGCCTTCTGGGCTTTCCTCTGGTTC
  GTGGGATTCTGCTACCTGGCCAACCAGTGGCAGGTCTCCAAGCCCAAGGACAACCCACTG
  AACGAAGGGACGGACGCAGCCCGGGCCGCCATCGCCTTCTCCTTTTTCTCCATCTTCACC
  TGGGCGGGCCAGGCTGTGCTGGCCTTCCAGCGGTACCAGATTGGCGCCGACTCGGCCCTC
  TTCTCCCAGGACTACATGGACCCCAGCCAGGACTCCAGCATGCCTTACGCGCCCTACGTG
  GAGCCCACTGGGCCGGATCCCGCCGGTATGGGCGGCACCTACCAGCAGCCGGCCAACACC
  TTCGACACCGAGCCCCAGGGCTACCAGTCGCAGGGCTAC
  
• Restriction Sites: Please inquire
• ACCN: NM_004711
• ORF Size: 702 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_004711.3, NP_004702.2
• RefSeq Size: 4425
• RefSeq ORF: 702
• Locus ID: 9145
• Domains: Synaptogyrin
• Protein Families: Transmembrane
• Gene Summary: This gene encodes an integral membrane protein associated with presynaptic vesicles in neuronal cells. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it functions in synaptic plasticity without being required for synaptic transmission. The gene product belongs to the synaptogyrin gene family. Three alternatively spliced variants encoding three different isoforms have been identified. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1a) represents the longest transcript and encodes the longest predominantly expressed isoform.