DNAJC3 (BC033823) Human Untagged Clone

CAT#: SC312569

(untagged)-Homo sapiens, Similar to DnaJ (Hsp40) homolog, subfamily C, member 3, clone MGC:45210 IMAGE:5218144, complete cds

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DNAJC3
• Synonyms: ACPHD|ERdj6|HP58|P58|P58IPK|PRKRI
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for BC033823, the custom clone sequence may differ by one or more nucleotides
  ATGGTGGCCCCCGGCTCCGTGACCAGCCGGCTGGGCTCGGTATTCCCCTTCCTGCTAGTC
  CTGGTGGATCTGCAGTACGAAGGTGCTGAATGTGGAGTAAATGCAGATGTTGAGAAACAT
  CTTGAATTGGGCAAGAAATTACTTGCAGCTGGACAGCTAGCTGATGCTTTATCTCAGTTT
  CATGCTGCCGTAGATGGTGACCCTGATAACTATATTGCTTATTATCGGAGGGCTACTGTC
  TTTTTAGCTATGGGCAAATCAAAAGCTGCACTTCCTGATTTAACTAAAGTGATTCAATTG
  AAGATGGACTTCACTGCAGCAAGATTACAGAGAGGTCACTTATTACTCAAACAAGGAAAA
  CTTGATGAAGCAGAAGATGATTTTAAAAAAGTGGTGTTTCCTGTTCCTTCTCTGTTGGGA
  CTCCAGCGTTCTCTCCTAGATGATCTATACTTGCTATTTTGGTTCTTCCTTATGAAGAAG
  GTGACTTTCAGATGCCTCTCGTCAGCCATCTCTGAATGCCTTCCTCAGTCTTTAAATTTG
  ATGAAGTTCAATTTGTTGATTTCCTTTTTACTTCTGTGGACTGTGCGTTTGGTGTCATGT
  CTAAGAAGTATTCACTACGCCGTAGGATCTAAAACTTTTCTCATATCTTCTAAAAGTTTT
  ATGGTTTTGTGTTTTATTTTTAAGCCCATAGTCTATTTGAGT
  
• Restriction Sites: Please inquire
• ACCN: BC033823
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC033823.1
• RefSeq Size: 3460 bp
• RefSeq ORF: 3460 bp
• Locus ID: 5611
• Cytogenetics: 13q32.1
• Domains: TPR
• Gene Summary: 'This gene encodes a protein with multiple tetratricopeptide repeat (TPR) motifs as well as the highly conserved J domain found in DNAJ chaperone family members. It is a member of the tetratricopeptide repeat family of proteins and acts as an inhibitor of the interferon-induced, dsRNA-activated protein kinase (PKR). [provided by RefSeq, Jul 2010]'