APRIL (TNFSF13) (NM_172087) Human Untagged Clone
CAT#: SC312571
TNFSF13 (untagged)-Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant beta
"NM_172087" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | TNFSF13 |
| Synonyms | APRIL; CD256; TALL-2; TALL2; TNLG7B; TRDL-1; UNQ383/PRO715; ZTNF2 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_172087 edited
ATGCCAGCCTCATCTCCTTTCTTGCTAGCCCCCAAAGGGCCTCCAGGCAACATGGGGGGC CCAGTCAGAGAGCCGGCACTCTCAGTTGCCCTCTGGTTGAGTTGGGGGGCAGCTCTGGGG GCCGTGGCTTGTGCCATGGCTCTGCTGACCCAACAAACAGAGCTGCAGAGCCTCAGGAGA GAGGTGAGCCGGCTGCAGAGGACAGGAGGCCCCTCCCAGAATGGGGAAGGGTATCCCTGG CAGAGTCTCCCGGAGCAGAGTTCCGATGCCCTGGAAGCCTGGGAGAGTGGGGAGAGATCC CGGAAAAGGAGAGCAGTGCTCACCCAAAAACAGAAGAATGACTCCGATGTGACAGAGGTG ATGTGGCAACCAGCTCTTAGGCGTGGGAGAGGCCTACAGGCCCAAGGATATGGTGTCCGA ATCCAGGATGCTGGAGTTTATCTGCTGTATAGCCAGGTCCTGTTTCAAGACGTGACTTTC ACCATGGGTCAGGTGGTGTCTCGAGAAGGCCAAGGAAGGCAGGAGACTCTATTCCGATGT ATAAGAAGTATGCCCTCCCACCCGGACCGGGCCTACAACAGCTGCTATAGCGCAGGTGTC TTCCATTTACACCAAGGGGATATTCTGAGTGTCATAATTCCCCGGGCAAGGGCGAAACTT AACCTCTCTCCACATGGAACCTTCCTGGGGTTTGTGAAACTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_172087 |
| ORF Size | 705 bp |
| Insert Size | 1840 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found two SNPs within the protein associated with this reference, NM_172087.2. |
| Reference Data | |
| RefSeq | NM_172087.1, NP_742084.1 |
| RefSeq Size | 2228 |
| RefSeq ORF | 705 |
| Locus ID | 8741 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF17/BCMA, a member of the TNF receptor family. This protein and its receptor are both found to be important for B cell development. In vitro experiments suggested that this protein may be able to induce apoptosis through its interaction with other TNF receptor family proteins such as TNFRSF6/FAS and TNFRSF14/HVEM. Alternative splicing results in multiple transcript variants. Some transcripts that skip the last exon of the upstream gene (TNFSF12) and continue into the second exon of this gene have been identified; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (beta) lacks an alternate in-frame exon in the central coding region, compared to variant alpha, resulting in an isoform (beta) that is shorter than isoform alpha. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220974 | TNFSF13 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant beta |
USD 420.00 |
|
| RG220974 | TNFSF13 (GFP-tagged) - Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant beta |
USD 460.00 |
|
| RC220974L3 | Lenti-ORF clone of TNFSF13 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant beta |
USD 620.00 |
|
| RC220974L4 | Lenti-ORF clone of TNFSF13 (mGFP-tagged)-Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant beta |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China