Adenylate kinase 5 (AK5) (AK090967) Human Untagged Clone

CAT#: SC312597

(untagged)-Human cDNA FLJ33648 fis, clone BRAMY2024449, weakly similar to ADENYLATE KINASE ISOENZYME 1 (EC 2.7.4.3)


Reconstitution Protocol

USD 960.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AK5
Synonyms AK6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK090967, the custom clone sequence may differ by one or more nucleotides
ATGAACACCAACGATGCCAAGGAGTATCTGGCCCGGAGGGAAATCCCTCAGCTTTTTGAG
AGCCTTTTGAATGGACTGATGTGTTCTAAGCCCGAAGATCCAGTAGAATACTTGGAAAGT
TGTTTACAAAAAGTAAAGGAACTGGGTGGCTGTGACAAGGTGAAATGGGATACATTTGTA
AGCCAGGAAAAGAAGACCTTACCCCCACTAAATGGAGGACAGTCACGGAGATCCTTTCTA
AGAAATGAAAGTGACACGGATCTCTCTGAGACTGCAGAGTTGATTGAGGAGTATGAGGTT
TTTGATCCTACCAGACCTCGACCAAAAATCATTCTTGTTATAGGTGGTCCAGGAAGTGGA
AAGGGTACTCAGAGTTTGAAAATTGCAGAACGATATGGATTCCAATACATTTCTGTGGGA
GAATTATTAAGAAAGAAGATCCACAGTACCAGCAGCAATAGGAAATGGAGTCTTATTGCC
AAGATAATTACAACTGGAGAATTGGCCCCACAGGAAACAACAATTACAGAGATAAAACAA
AAATTGATGCAAATACCTGATGAAGAGGGCATTGTTATTGATGGATTTCCAAGAGATGTT
GCCCAGGCTCTATCTTTTGAGGACCAATACAGCCTACGCCCTCAGACAAAGATGCCTGTG
CAGTCAGATCCTCTCCCTTACGCTGCTCCCTGCGGGGTATGTCCAGTCCGTCAAGATTCT
CCC
Restriction Sites Please inquire     
ACCN AK090967
ORF Size 2148 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq AK090967.1, BAC03558.1
RefSeq Size 2148
RefSeq ORF 2148
Locus ID 26289
Domains ADK
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
Gene Summary This gene encodes a member of the adenylate kinase family, which is involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. This member is related to the UMP/CMP kinase of several species. It is located in the cytosol and expressed exclusively in brain. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.