RTN3 (NM_201430) Human Untagged Clone

CAT#: SC312600

RTN3 (untagged)-Human reticulon 3 (RTN3), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RTN3
• Synonyms: ASYIP; HAP; NSPL2; NSPLII; RTN3-A1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_201430, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGAGCCGTCGGCGGCCACTCAGTCCCATTCCATCTCCTCGTCGTCCTTCGGAGCCGAGCCGTCCG
  CGCCCGGCGGCGGCGGGAGCCCAGGAGCCTGCCCCGCCCTGGGGACGAAGAGCTGCAGCTCCTCCTGTGC
  GGTGCACGATCTGATTTTCTGGAGAGATGTGAAGAAGACTGGGTTTGTCTTTGGCACCACGCTGATCATG
  CTGCTTTCCCTGGCAGCTTTCAGTGTCATCAGTGTGGTTTCTTACCTCATCCTGGCTCTTCTCTCTGTCA
  CCATCAGCTTCAGGATCTACAAGTCCGTCATCCAAGCTGTACAGAAGTCAGAAGAAGGCCATCCATTCAA
  AGCCTACCTGGACGTAGACATTACTCTGTCCTCAGAAGCTTTCCATAATTACATGAATGCTGCCATGGTG
  CACATCAACAGGGCCCTGAAACTCATTATTCGTCTCTTTCTGGTAGAAGATCTGGTTGACTCCTTGAAGC
  TGGCTGTCTTCATGTGGCTGATGACCTATGTTGGTGCTGTTTTTAACGGAATCACCCTTCTAATTCTTGC
  TGAACTGCTCATTTTCAGTGTCCCGATTGTCTATGAGAAGTACAAGGATCCAAGCAAAACTCCCTGGAAT
  CGCCAAAAAAAAGGCAGAATAAGTACATGGAAACCAGAAATGCAACAGTTACTAAAACACCATTTAATAG
  TTATAACGTCGTTACTTGTACTATGA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_201430
• ORF Size: 726 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_201430.1, NP_958833.1
• RefSeq Size: 2542
• RefSeq ORF: 726
• Locus ID: 10313
• Protein Families: Transmembrane
• Gene Summary: This gene belongs to the reticulon family of highly conserved genes that are preferentially expressed in neuroendocrine tissues. This family of proteins interact with, and modulate the activity of beta-amyloid converting enzyme 1 (BACE1), and the production of amyloid-beta. An increase in the expression of any reticulon protein substantially reduces the production of amyloid-beta, suggesting that reticulon proteins are negative modulators of BACE1 in cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, and pseudogenes of this gene are located on chromosomes 4 and 12. [provided by RefSeq, May 2012]
  Transcript Variant: This variant (4) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (d) is longer and has a distinct C-terminus, compared to isoform a.