SCD5 (NM_024906) Human Untagged Clone

CAT#: SC312669

SCD5 (untagged)-Human stearoyl-CoA desaturase 5 (SCD5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SCD5
• Synonyms: ACOD4; FADS4; HSCD5; SCD2; SCD4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_024906, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCAGGCCCGGCCACCGACGCGGGGAAGATCCCTTTCTGCGACGCCAAGGAAGAAATCCGTGCCGGGC
  TCGAAAGCTCTGAGGGCGGCGGCGGCCCGGAGAGGCCAGGCGCGCGCGGGCAGCGGCAGAACATCGTCTG
  GAGGAATGTCGTCCTGATGAGCTTGCTCCACTTGGGGGCCGTGTACTCCCTGGTGCTCATCCCCAAAGCC
  AAGCCACTCACTCTGCTCTGGGCCTACTTCTGCTTCCTCCTGGCCGCTCTGGGTGTGACAGCTGGTGCCC
  ATCGCTTGTGGAGCCACAGGTCCTACCGGGCCAAGCTGCCTCTGAGGATATTTCTGGCTGTCGCCAACTC
  CATGGCTTTCCAGAATGACATCTTCGAGTGGTCCAGGGACCACCGAGCCCACCACAAGTACTCAGAGACG
  GATGCTGACCCCCACAATGCCCGCCGGGGCTTCTTCTTCTCCCATATTGGGTGGCTGTTTGTTCGCAAGC
  ATCGAGATGTTATTGAGAAGGGGAGAAAGCTTGACGTCACTGACCTGCTTGCTGATCCTGTGGTCCGGAT
  CCAGAGAAATACACAGCACATCCAGAAAGAAGGAAGAGCTCTCAATCAAGAGGCAGCGTGTGAGATGCTT
  CGTGAATGGCATCAAGGGCATATATTGAAAGTCACCCTTCCCGGATTACACATTTTAGCTTTGTTACATA
  CTCATTGTAACCACTCCGAAAAGTGCTGCTTGATGCTGCGTGCTCTTTCTGTGTCCCTGGAGGTATTCTG
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_024906
• ORF Size: 771 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_024906.2, NP_079182.2
• RefSeq Size: 2080
• RefSeq ORF: 771
• Locus ID: 79966
• Domains: FA_desaturase
• Protein Families: Transmembrane
• Protein Pathways: Biosynthesis of unsaturated fatty acids, PPAR signaling pathway
• Gene Summary: Stearoyl-CoA desaturase (SCD; EC 1.14.99.5) is an integral membrane protein of the endoplasmic reticulum that catalyzes the formation of monounsaturated fatty acids from saturated fatty acids. SCD may be a key regulator of energy metabolism with a role in obesity and dislipidemia. Four SCD isoforms, Scd1 through Scd4, have been identified in mouse. In contrast, only 2 SCD isoforms, SCD1 (MIM 604031) and SCD5, have been identified in human. SCD1 shares about 85% amino acid identity with all 4 mouse SCD isoforms, as well as with rat Scd1 and Scd2. In contrast, SCD5 shares limited homology with the rodent SCDs and appears to be unique to primates (Wang et al., 2005 [PubMed 15907797]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (2) has multiple differences in the 3' coding region, compared to variant 1, which result in a protein (isoform B) with a shorter and distinct C-terminus, compared to isoform A.