PHOSPHO1 (NM_178500) Human Untagged Clone

CAT#: SC312714

PHOSPHO1 (untagged)-Human phosphatase, orphan 1 (PHOSPHO1), transcript variant 2


  "NM_178500" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PHOSPHO1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PHOSPHO1
Synonyms phosphatase, orphan 1; phosphoethanolamine/phosphocholine phosphatase
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_178500, the custom clone sequence may differ by one or more nucleotides


ATGAGTGGCTGTTTTCCAGTTTCTGGCCTCCGCTGCCTATCTAGGGACGGCAGGATGGCCGCGCAGGGCG
CGCCGCGCTTCCTCCTGACCTTCGACTTCGACGAGACTATCGTGGACGAAAACAGCGACGATTCGATCGT
GCGCGCCGCGCCGGGCCAGCGGCTCCCGGAGAGCCTGCGAGCCACCTACCGCGAGGGCTTCTACAACGAG
TACATGCAGCGCGTCTTCAAGTACCTGGGCGAGCAGGGCGTGCGGCCGCGGGACCTGAGCGCCATCTACG
AAGCCATCCCTTTGTCGCCAGGCATGAGCGACCTGCTGCAGTTTGTGGCAAAACAGGGCGCCTGCTTCGA
GGTGATTCTCATCTCCGATGCCAACACCTTTGGCGTGGAGAGCTCGCTGCGCGCCGCCGGCCACCACAGC
CTGTTCCGCCGCATCCTCAGCAACCCGTCGGGGCCGGATGCGCGGGGACTGCTGGCTCTGCGGCCGTTCC
ACACACACAGCTGCGCGCGCTGCCCCGCCAACATGTGCAAGCACAAGGTGCTCAGCGACTACCTGCGCGA
GCGGGCCCACGACGGCGTGCACTTCGAGCGCCTCTTCTACGTGGGCGACGGCGCCAACGACTTCTGCCCC
ATGGGGCTGCTGGCGGGCGGCGACGTGGCCTTCCCGCGCCGCGGCTACCCCATGCACCGCCTCATTCAGG
AGGCCCAGAAGGCCGAGCCCAGCTCGTTCCGCGCCAGCGTGGTGCCCTGGGAAACGGCTGCAGATGTGCG
CCTCCACCTGCAACAGGTGCTGAAGTCGTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_178500
ORF Size 804 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_178500.3, NP_848595.1
RefSeq Size 2046
RefSeq ORF 804
Locus ID 162466
Protein Families Druggable Genome
Protein Pathways Glycerophospholipid metabolism
Gene Summary Phosphatase that has a high activity toward phosphoethanolamine (PEA) and phosphocholine (PCho). Involved in the generation of inorganic phosphate for bone mineralization. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses a different splice site, compared to variant 1, that results in the use of an upstream start codon. The resulting protein (isoform 2) has a shorter and distinct N-terminus when it is compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.