PSMF1 (NM_178578) Human Untagged Clone
CAT#: SC312741
PSMF1 (untagged)-Human proteasome (prosome, macropain) inhibitor subunit 1 (PI31) (PSMF1), transcript variant 2
"NM_178578" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PSMF1 |
Synonyms | PI31 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_178578, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGCCTGGAGGTACTGTTCGCATCGGCAGCGCCGGCCATCACCTGCAGGCAGGACGCGCTCGTCT GCTTCTTGCATTGGGAAGTGGTGACACACGGTTACTTCGGCTTGGGTGTCGGTGACCAGCCGGGTCCCAA TGATAAGAAGTCAGAACTGCTGCCAGCTGGGTGGAACAACAATAAAGACCTGTATGTCCTCCGGTATGAG TATAAGGATGGGTCCAGAAAGCTCCTTGTGAAAGCCATCACCGTGGAGAGCAGCATGATCCTCAATGTGC TGGAATATGGCTCACAGCAAGTGGCAGACTTGACCCTGAACTTGGATGATTATATCGATGCAGAACACCT GGGTGACTTCCACAGGACCTACAAGAACAGTGAGGAGCTTCGGTCTCGTATTGTGTCTGGAATCATCACA CCTATCCATGAGCAGTGGGAAAAGGCTAATGTAAGCAGTCCCCACCGGGAGTTCCCCCCTGCTACCGCCA GAGAGGTGGACCCACTCCGGATTCCTCCACACCACCCACACACCAGTCGGCAGCCTCCCTGGTGTGATCC CCTGGGCCCGTTTGTTGTCGGGGGAGAAGACTTAGACCCTTTTGGGCCTCGGAGAGGTGGCATGATTGTG GATCCCCTGAGATCTGGCTTCCCAAGAGCACTTATTGACCCTTCCTCAGGCCTCCCGAACCGACTTCCTC CAGGCGCTGTGCCCCCAGGAGCTCGCTTTGACCCCTTTGGACCCATTGGGACCAGCCCACCCGGACCTAA CCCAGACCATCTCCCCCCGCCGGGCTACGATGACATGTACCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_178578 |
ORF Size | 816 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_178578.3, NP_848693.2 |
RefSeq Size | 8195 |
RefSeq ORF | 816 |
Locus ID | 9491 |
Protein Pathways | Proteasome |
Gene Summary | The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a protein that inhibits the activation of the proteasome by the 11S and 19S regulators. Alternative transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215482 | PSMF1 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) inhibitor subunit 1 (PI31) (PSMF1), transcript variant 2 |
USD 420.00 |
|
RG215482 | PSMF1 (GFP-tagged) - Human proteasome (prosome, macropain) inhibitor subunit 1 (PI31) (PSMF1), transcript variant 2 |
USD 460.00 |
|
RC215482L3 | Lenti ORF clone of Human proteasome (prosome, macropain) inhibitor subunit 1 (PI31) (PSMF1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC215482L4 | Lenti ORF clone of Human proteasome (prosome, macropain) inhibitor subunit 1 (PI31) (PSMF1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review