GALNT10 (NM_017540) Human Untagged Clone

CAT#: SC312762

GALNT10 (untagged)-Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10) (GALNT10), transcript variant 2


  "NM_017540" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GALNT10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GALNT10
Synonyms DKFZp586H0623; FLJ00205; FLJ11715; GalNAcT10; pp-GalNAc-T10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_017540, the custom clone sequence may differ by one or more nucleotides


ATGCTGGCCTGGCGGGATGGTGAACTGGAAGCAGAAACGTCATCCTCTCTCTTCCTTCTTGCCATGCAGG
TGTGGATGTGTGGGGGCCGCATGGAGGACATCCCCTGCTCCAGGGTGGGCCATATCTACAGGAAGTATGT
GCCCTACAAGGTCCCGGCCGGAGTCAGCCTGGCCCGGAACCTTAAGCGGGTGGCCGAAGTGTGGATGGAT
GAGTACGCAGAGTACATTTACCAGCGCCGGCCTGAATACCGCCACCTCTCCGCTGGGGATGTCGCAGTCC
AGAAAAAGCTCCGCAGCTCCCTTAACTGCAAGAGTTTCAAGTGGTTTATGACGAAGATAGCCTGGGACCT
GCCCAAATTCTACCCACCCGTGGAGCCCCCGGCTGCAGCTTGGGGGGAGATCCGAAATGTGGGCACAGGG
CTGTGTGCAGACACAAAGCACGGGGCCTTGGGCTCCCCACTAAGGCTAGAGGGCTGCGTCCGAGGCCGTG
GGGAGGCTGCCTGGAACAACATGCAGGTATTCACCTTCACCTGGAGAGAGGACATCCGGCCTGGAGACCC
CCAGCACACCAAGAAGTTCTGCTTTGATGCCATTTCCCACACCAGCCCTGTCACGCTGTACGACTGCCAC
AGCATGAAGGGCAACCAGCTGTGGAAATACCGCAAAGACAAGACCCTGTACCACCCTGTCAGTGGCAGCT
GCATGGACTGCAGTGAAAGTGACCATAGGATCTTCATGAACACCTGCAACCCATCCTCTCTCACCCAGCA
GTGGCTGTTTGAACACACCAACTCAACAGTCTTGGAAAAATTCAATAGGAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_017540
ORF Size 825 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_017540.3, NP_060010.3
RefSeq Size 4361
RefSeq ORF 825
Locus ID 55568
Domains RICIN
Protein Families Transmembrane
Protein Pathways Metabolic pathways, O-Glycan biosynthesis
Gene Summary This gene encodes a member of the GalNAc polypeptide N-acetylgalactosaminyltransferases. These enzymes catalyze the first step in the synthesis of mucin-type oligosaccharides. These proteins transfer GalNAc from UDP-GalNAc to either serine or threonine residues of polypeptide acceptors. The protein encoded by this locus may have increased catalytic activity toward glycosylated peptides compared to activity toward non-glycosylated peptides. [provided by RefSeq, Apr 2010]
Transcript Variant: This variant (2) differs in the 5' UTR and the 5' coding region, compared to variant 1. The resulting isoform (b) contains a distinct N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.