SLC8A3 (NM_182936) Human Untagged Clone

CAT#: SC312802

SLC8A3 (untagged)-Human solute carrier family 8 (sodium/calcium exchanger), member 3 (SLC8A3), transcript variant f


  "NM_182936" in other vectors (4)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC8A3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC8A3
Synonyms NCX3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_182936, the custom clone sequence may differ by one or more nucleotides
ATGGAAGAAGAGGAGGCCAAGAGGATAGCAGAGATGGGAAAGCCAGTATTGGGTGAACAC
CCCAAACTAGAAGTCATCATTGAAGAGTCCTATGAGTTCAAGACTACGGTGGACAAACTG
ATCAAGAAGACAAACCTGGCCTTGGTTGTGGGGACCCATTCCTGGAGGGACCAGTTCATG
GAGGCCATCACCGTCAGTGCAGCAGGGGATGAGGATGAGGATGAATCCGGGGAGGAGAGG
CTGCCCTCCTGCTTTGACTACGTCATGCACTTCCTGACTGTCTTCTGGAAGGTGCTGTTT
GCCTGTGTGCCCCCCACAGAGTACTGCCACGGCTGGGCCTGCTTCGCCGTCTCCATCCTC
ATCATTGGCATGCTCACCGCCATCATTGGGGACCTGGCCTCGCACTTCGGCTGCACCATT
GGTCTCAAAGATTCAGTCACAGCTGTTGTTTTCGTGGCATTTGGCACCTCTGTCCCAGAT
ACGTTTGCCAGCAAAGCTGCTGCCCTCCAGGATGTATATGCAGACGCCTCCATTGGCAAC
GTGACGGGCAGCAACGCCGTCAATGTCTTCCTGGGCATCGGCCTGGCCTGGTCCGTGGCC
GCCATCTACTGGGCTCTGCAGGGACAGGAGTTCCACGTGTCGGCCGGCACACTGGCCTTC
TCCGTCACCCTCTTCACCATCTTTGCATTTGTCTGCATCAGCGTGCTCTTGTACCGAAGG
CGGCCGCACCTGGGAGGGGAGCTTGGTGGCCCCCGTGGCTGCAAGCTCGCCACAACATGG
CTCTTTGTGAGCCTGTGGCTCCTCTACATACTCTTTGCCACACTAGAGGCCTATTGCTAC
ATCAAGGGGTTC
Restriction Sites Please inquire     
ACCN NM_182936
ORF Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_182936.1, NP_891981.1
RefSeq Size 2845
RefSeq ORF 855
Locus ID 6547
Protein Families Transmembrane
Protein Pathways Calcium signaling pathway
Gene Summary This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (f, also known as NCX3-tN.1) differs in the presence and absence of exons at its 5' end, compared to variant c. These differences result in a distinct 5' UTR and translation initiation at a downstream start codon, and an isoform (F) that is shorter than isoform C.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.