NALP12 (NLRP12) (NM_033297) Human Untagged Clone

CAT#: SC312810

NLRP12 (untagged)-Human NLR family, pyrin domain containing 12 (NLRP12), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NLRP12
• Synonyms: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_033297, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCCAGGCATGGTGGCACACGTCTGTAAGCCCAGCTACTCAGGAGGCCAAGGCAGGAGGATTGCTTC
  AACCCAGGAGGCAGAGGTTGTGGCTGAAGAGGTGCCGCATCTCCAGCTCAGCCTGCGAGGACCTCTCTGC
  AGCTCTCATAGCCAATAAGAATTTGACAAGGATGGATCTCAGTGGCAACGGCGTTGGATTCCCAGGCATG
  ATGCTGCTTTGCGAGGGCCTGCGGCATCCCCAATGCAGGCTGCAGATGATTCAGTTGAGGAAGTGTCAGC
  TGGAGTCCGGGGCTTGTCAGGAGATGGCTTCTGTGCTCGGCACCAACCCACATCTGGTTGAGTTGGACCT
  GACAGGAAATGCACTGGAGGATTTGGGCCTGAGGTTACTATGCCAGGGACTGAGGCACCCAGTCTGCAGA
  CTACGGACTTTGTGGCTGAAGATCTGCCGCCTCACTGCTGCTGCCTGTGACGAGCTGGCCTCAACTCTCA
  GTGTGAACCAGAGCCTGAGAGAGCTGGACCTGAGCCTGAATGAGCTGGGGGACCTCGGGGTGCTGCTGCT
  GTGTGAGGGCCTCAGGCATCCCACGTGCAAGCTCCAGACCCTGCGGCTGGATAGCTGTGGCCTCACAGCC
  AAGGCTTGTGAGAATCTTTACTTCACCCTGGGGATCAACCAGACCTTGACCGACCTTTACCTGACCAACA
  ACGCCCTAGGGGACACAGGTGTCCGACTGCTTTGCAAGCGGCTGAGCCATCCTGGCTGCAAACTCCGAGT
  CCTCTGGTTATTTGGGATGGACCTGAATAAAATGACCCACAGTAGGTTGGCAGCGCTTCGAGTAACAAAA
  CCTTATTTGGACATTGGCTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_033297
• ORF Size: 864 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_033297.2, NP_150639.1
• RefSeq Size: 2638
• RefSeq ORF: 864
• Locus ID: 91662
• Domains: LRR, LRR_RI
• Gene Summary: This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
  Transcript Variant: This variant (1) differs in the 5' UTR, lacks multiple exons in the 5' coding region, and uses a downstream start codon compared to variant 2. The encoded isoform (1) is shorter and has a distinct N-terminus compared to isoform 2.