Cyclin Y (CCNY) (NM_181698) Human Untagged Clone

CAT#: SC312811

CCNY (untagged)-Human cyclin Y (CCNY), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCNY
• Synonyms: C10orf9; CBCP1; CCNX; CFP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181698, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAATTCAATCCTTCAGATCATCCTCGGGCCAGCACAATATTCCTCAGTAAATCTCAGACGGACGTGA
  GAGAAAAACGCAAGAGTCTCTTCATTAACCATCATCCTCCAGGACAAATAGCAAGGAAATACAGTTCCTG
  CTCCACCATTTTCCTAGATGATAGCACAGTCAGTCAACCAAACCTCAAGTATACAATTAAATGTGTCGCT
  CTTGCAATATATTATCACATCAAAAACAGGGACCCAGATGGAAGGATGCTCTTAGATATTTTTGATGAAA
  ATCTTCACCCTCTTTCGAAATCCGAAGTGCCACCAGATTATGACAAACACAACCCAGAGCAGAAGCAGAT
  TTACCGGTTCGTTCGGACACTGTTCAGTGCTGCTCAGCTGACGGCTGAATGTGCCATCGTCACCCTGGTG
  TACCTTGAAAGACTTTTAACATACGCAGAGATAGATATCTGTCCGGCCAACTGGAAGCGGATTGTTTTAG
  GGGCGATCCTGCTGGCCTCCAAGGTGTGGGATGACCAGGCTGTATGGAATGTGGATTACTGCCAGATCCT
  GAAAGACATCACGGTGGAGGACATGAACGAGCTAGAGCGACAGTTTCTTGAATTGCTGCAGTTCAACATC
  AATGTTCCTTCCAGTGTCTATGCCAAGTATTATTTTGATCTTCGTTCTCTGGCAGAAGCGAACAACCTGA
  GCTTTCCCTTGGAGCCCCTGAGCAGGGAGAGGGCTCACAAGCTTGAGGCCATCTCTCGCCTCTGCGAGGA
  CAAGTACAAGGACCTAAGAAGATCCGCGAGGAAGCGCTCAGCCAGTGCAGACAACCTGACTCTGCCCCGG
  TGGTCCCCAGCCATCATCTCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_181698
• ORF Size: 864 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_181698.3, NP_859049.2
• RefSeq Size: 4735
• RefSeq ORF: 864
• Locus ID: 219771
• Gene Summary: Cyclins, such as CCNY, control cell division cycles and regulate cyclin-dependent kinases (e.g., CDC2; MIM 116940) (Li et al., 2009 [PubMed 18060517]). [supplied by OMIM, May 2009]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon, compared to variant 1. Variants 2 and 4 encode the same isoform (2), which has a shorter N-terminus than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.