ATP1B2 (NM_001678) Human Untagged Clone

CAT#: SC312822

ATP1B2 (untagged)-Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP1B2
• Synonyms: AMOG
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001678, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTCATCCAGAAAGAGAAGAAGAGCTGCGGGCAGGTGGTTGAGGAGTGGAAGGAGTTCGTGTGGAACC
  CGAGGACGCACCAGTTTATGGGCCGCACCGGGACCAGCTGGGCCTTTATCCTCCTCTTCTACCTCGTTTT
  TTATGGGTTCCTCACCGCCATGTTCACCCTCACCATGTGGGTGATGCTGCAGACTGTCTCCGACCATACC
  CCCAAGTACCAGGACCGACTGGCCACACCGGGCTTGATGATTCGCCCCAAGACTGAGAACCTTGATGTCA
  TTGTCAATGTCAGTGACACTGAAAGCTGGGACCAGCATGTTCAGAAGCTCAACAAGTTCTTGGAGCCTTA
  CAACGACTCTATCCAAGCCCAAAAGAATGATGTCTGCCGCCCTGGACGCTATTACGAACAGCCAGATAAT
  GGAGTCCTCAACTACCCCAAACGTGCCTGCCAATTCAACCGGACCCAGCTGGGCAACTGCTCCGGCATTG
  GGGACTCCACCCACTATGGTTACAGCACTGGGCAGCCCTGTGTCTTCATCAAGATGAACCGGGTCATCAA
  CTTCTATGCAGGAGCAAACCAGAGCATGAATGTTACCTGTGCTGGGAAGCGAGATGAAGATGCTGAGAAT
  CTCGGCAACTTCGTCATGTTCCCCGCCAACGGCAACATCGACCTCATGTACTTCCCCTACTATGGCAAAA
  AGTTCCACGTGAACTACACACAGCCCCTGGTGGCTGTGAAGTTCCTGAATGTGACCCCCAACGTGGAGGT
  GAATGTAGAATGTCGCATCAACGCCGCCAACATCGCCACAGACGATGAGCGAGACAAGTTCGCCGGCCGC
  GTGGCCTTCAAACTCCGCATCAACAAAACCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001678
• ORF Size: 873 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001678.4, NP_001669.3
• RefSeq Size: 3396
• RefSeq ORF: 873
• Locus ID: 482
• Domains: Na_K-ATPase
• Protein Families: Transmembrane
• Protein Pathways: Cardiac muscle contraction
• Gene Summary: The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 2 subunit. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.