CLEC10A (NM_006344) Human Untagged Clone

CAT#: SC312828

CLEC10A (untagged)-Human C-type lectin domain family 10, member A (CLEC10A), transcript variant 2


  "NM_006344" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CLEC10A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CLEC10A
Synonyms CD301; CLECSF13; CLECSF14; HML; HML2; MGL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_006344, the custom clone sequence may differ by one or more nucleotides


ATGACAAGGACGTATGAAAACTTCCAGTACTTGGAGAATAAGGTGAAAGTCCAGGGGTTTAAAAATGGGC
CACTTCCTCTCCAGTCCCTCCTGCAGCGTCTCTGCTCTGGGCCCTGCCATCTCCTGCTGTCCCTGGGCCT
CGGCCTCCTGCTGCTGGTCATCATCTGTGTGGTTGGATTCCAAAATTCCAAATTTCAGAGGGACCTGGTG
ACCCTGAGAACAGATTTTAGCAACTTCACCTCAAACACTGTGGCGGAGATCCAGGCACTGACTTCCCAGG
GCAGCAGCTTGGAAGAAACGATAGCATCTCTGAAAGCTGAGGTGGAGGGTTTCAAGCAGGAACGGCAGGC
AGTTCATTCTGAAATGCTCCTGCGAGTCCAGCAGCTGGTGCAAGACCTGAAGAAACTGACCTGCCAGGTG
GCTACTCTCAACAACAATGGTGAGGAAGCCTCCACTGAAGGGACCTGCTGCCCTGTCAACTGGGTGGAGC
ACCAAGACAGCTGCTACTGGTTCTCTCACTCTGGGATGTCCTGGGCCGAGGCTGAGAAGTACTGCCAGCT
GAAGAACGCCCACCTGGTGGTCATCAACTCCAGGGAGGAGCAGAATTTTGTCCAGAAATATCTAGGCTCC
GCATACACCTGGATGGGCCTCAGTGACCCTGAAGGAGCCTGGAAGTGGGTGGATGGAACAGACTATGCGA
CCGGCTTCCAGAACTGGAAGCCAGGCCAGCCAGACGACTGGCAGGGGCACGGGCTGGGTGGAGGCGAGGA
CTGTGCTCACTTCCATCCAGACGGCAGGTGGAATGACGACGTCTGCCAGAGGCCCTACCACTGGGTCTGC
GAGGCTGGCCTGGGTCAGACCAGCCAGGAGAGTCACTGA


Restriction Sites SgfI-MluI     
ACCN NM_006344
ORF Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_006344.2, NP_006335.2
RefSeq Size 1716
RefSeq ORF 879
Locus ID 10462
Domains CLECT, lectin_N
Protein Families Transmembrane
Gene Summary This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may function as a cell surface antigen. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (2), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.