Tapasin (TAPBP) (NM_172208) Human Untagged Clone

CAT#: SC312855

TAPBP (untagged)-Human TAP binding protein (tapasin) (TAPBP), transcript variant 2


  "NM_172208" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAPBP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAPBP
Synonyms NGS17; TAPA; TPN; TPSN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_172208, the custom clone sequence may differ by one or more nucleotides


ATGAAGTCCCTGTCTCTGCTCCTCGCTGTGGCTTTGGGCCTGGCGACCGCCGTCTCAGCAGGACCCGCGG
TGATCGAGTGTTGGTTCGTGGAGGATGCGAGCGGAAAGGGCCTGGCCAAGAGACCCGGTGCACTGCTGTT
GCGCCAGGGACCGGGGGAACCGCCGCCCCGGCCGGACCTCGACCCTGAGCTCTATCTCAGTGTACACGAC
CCCGCGGGCGCCCTCCAGGCTGCCTTCAGGCGGTATCCCCGGGGCGCCCCCGCACCACACTGCGAGATGA
GCCGCTTCGTGCCTCTCCCCGCCTCTGCGAAATGGGCCAGCGGCCTGACCCCCGCGCAGAACTGCCCGCG
GGCCCTGGATGGGGCTTGGCTGATGGTCAGCATATCCAGCCCAGTCCTCAGCCTCTCCAGCCTCTTGCGA
CCACAGCCAGAGCCTCAGCAGGAGCCTGTTCTCATCACCATGGCAACAGTGGTACTGACTGTCCTCACCC
ACACCCCTGCCCCTCGAGTGAGACTGGGACAAGATGCTCTGCTGGACTTGAGCTTTGCCTACATGCCCCC
CACCTCCGAGGCCGCCTCATCTCTGGCTCCGGGTCCCCCTCCCTTTGGGCTAGAGTGGCGACGCCAGCAC
CTGGGTAAGGGACATCTGCTCCTGGCTGCAACTCCTGGGCTGAATGGCCAGATGCCAGCAGCCCAAGAAG
GGGCCGTGGCATTTGCTGCTTGGGATGATGATGAGCCATGGGGCCCATGGACCGGAAATGGGACCTTCTG
GCTGCCTACAGTTCAACCCTTTCAGGAGGGCACCTATCTGGCCACCATACACCTGCCATACCTGCAAGGA
CAGGTCACCCTGGAGCTTGCTGTGTACAAACCCCCCAAAGTGTCCCTGATGCCAGCAACCCTTGCACGGG
CCGCCCCAGGGGAGGCACCCCCGGAATTGCTCTGCCTTGTGTCCCACTTCTACCCTTCTGGGGGCCTGGA
GGTGGAGTGGGAACTCCGGGGTGGCCCAGGGGGCCGCTCTCAGAAGGCCGAGGGGCAGAGGTGGCTCTCG
GCCCTGCGCCACCATTCCGATGGCTCTGTCAGCCTCTCTGGGCACTTGCAGCCGCCCCCAGTCACCACTG
AGCAGCATGGGGCACGCTATGCCTGTCGAATTCACCATCCCAGCCTGCCTGCCTCGGGGCGCAGCGCTGA
GGTCACCCTGGAGGTAGCAGGTCTTTCAGGGCCCTCCCTTGAGGACAGCGTAGGCCTTTTCCTGTCTGCC
TTTCTTCTGCTTGGGCTCTTCAAGGCACTGGGCTGGGCTGCTGTCTACCTGTCCACCTGCAAGGATTCAA
AGAAGGTACAGTGCTCCACCTCTCTGTATCTTTCCCTTGTCACTTTATCTCCTCATCCTATCTCAAAACC
CATGGAGGGAGGCTGCTGGTGTGGTAGGCAGAACCTAGGCTTGGAATTCACACTGATCTGGGTTAAAACC
TGGCACTATATCCTAACTGTAGGACTCTTTGAGCATGCTACTTAA


Restriction Sites SgfI-MluI     
ACCN NM_172208
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_172208.2, NP_757345.2
RefSeq Size 2003 bp
RefSeq ORF 1515 bp
Locus ID 6892
Cytogenetics 6p21.32
Protein Families Druggable Genome, Transmembrane
Protein Pathways Antigen processing and presentation
Gene Summary 'This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.