RNASEH2B (NM_024570) Human Untagged Clone

CAT#: SC312913

RNASEH2B (untagged)-Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNASEH2B
• Synonyms: AGS2; DLEU8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_024570, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCGCTGGCGTGGACTGCGGGGACGGGGTTGGCGCCCGGCAGCACGTGTTCCTGGTTTCAGAATATT
  TAAAAGATGCTTCAAAGAAGATGAAAAATGGGCTAATGTTTGTAAAACTGGTTAACCCCTGTTCAGGAGA
  AGGAGCCATTTACTTGTTCAATATGTGTCTACAGCAGCTGTTTGAAGTAAAAGTTTTCAAGGAAAAACAC
  CATTCTTGGTTTATAAATCAATCAGTTCAATCAGGAGGTCTTCTCCATTTTGCCACACCTGTGGATCCTC
  TATTTCTGCTTCTCCACTACCTCATAAAGGCTGATAAGGAGGGGAAGTTTCAGCCCCTTGATCAAGTTGT
  GGTGGATAACGTGTTTCCAAATTGCATCTTGTTGCTGAAACTTCCTGGACTTGAGAAGTTACTTCATCAT
  GTGACAGAGGAAAAAGGTAATCCAGAAATAGACAACAAGAAATATTACAAGTACAGCAAAGAGAAGACAT
  TAAAGTGGCTGGAAAAAAAGGTTAATCAAACTGTGGCAGCATTAAAAACCAATAATGTGAATGTCAGTTC
  CCGGGTACAGTCAACTGCATTTTTCTCTGGTGACCAAGCTTCCACTGACAAGGAAGAGGATTATATTCGT
  TATGCCCATGGTCTGATATCTGACTACATCCCTAAAGAATTAAGTGATGACTTATCTAAATACTTAAAGC
  TTCCAGAACCTTCAGCCTCATTGCCAAATCCTCCATCAAAGAAAATAAAGTTATCAGATGAGCCTGTAGA
  AGCAAAAGAAGATTACACTAAGTTTAATACTAAAGATTTGAAGACTGAAAAGAAAAATAGCAAAATGACT
  GCAGCTCAGAAGGCTTTGGCTAAAGTTGACAAGAGTGGAATGAAAAGTATTGATACCTTTTTTGGGGTAA
  AAAATAAAAAAAAAATTGGAAAGGTTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_024570
• ORF Size: 939 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_024570.3, NP_078846.2
• RefSeq Size: 1691
• RefSeq ORF: 939
• Locus ID: 79621
• Protein Pathways: DNA replication
• Gene Summary: RNase H2 is composed of a single catalytic subunit (A) and two non-catalytic subunits (B and C) and specifically degrades the RNA of RNA:DNA hybrids. The protein encoded by this gene is the non-catalytic B subunit of RNase H2, which is thought to play a role in DNA replication. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Aicardi-Goutieres syndrome type 2 (AGS2). [provided by RefSeq, Nov 2008]
  Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (1).