C6orf134 (ATAT1) (NM_024909) Human Untagged Clone
CAT#: SC312949
ATAT1 (untagged)-Human alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 2
"NM_024909" in other vectors (9)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATAT1 |
Synonyms | alpha-TAT; alpha-TAT1; C6orf134; MEC17; Nbla00487; TAT |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_024909, the custom clone sequence may differ by one or more nucleotides
ATGGAGTTCCCGTTCGATGTGGACGCGCTGTTCCCGGAGCGGATCACGGTGCTGGACCAG CACCTGAGGCCCCCAGCCCGCCGACCCGGAACCACAACGCCGGCCCGTGTTGATCTACAG CAGCAAATTATGACCATTATAGATGAACTGGGCAAGGCTTCTGCCAAGGCCCAGAATCTT TCCGCTCCTATCACTAGTGCATCAAGGATGCAGAGTAACCGCCATGTTGTTTATATTCTC AAGGACAGTTCAGCCCGACCGGCTGGAAAAGGAGCCATTATTGGTTTCATCAAAGTTGGA TACAAGAAGCTCTTTGTACTGGATGATCGTGAGGCTCATAATGAGGTAGAACCACTTTGC ATCCTGGACTTTTACATCCATGAGTCTGTGCAACGCCATGGCCATGGGCGAGAACTCTTC CAGTATATGTTGCAGAAGGAGCGAGTGGAACCGCACCAACTGGCAATTGACCGACCCTCT CAGAAGCTGCTGAAATTCCTGAATAAGCACTACAATCTGGAGACCACAGTCCCACAGGTG AACAACTTTGTGATCTTTGAAGGCTTCTTTGCCCATCAACATCGGCCCCCTGCTCCCTCT CTGAGGGCAACTCGACACTCTCGTGCTGCTGCAGTCGATCCCACGCCCGCTGCTCCAGCA AGGAAGCTGCCACCCAAGAGAGCAGAGGGAGACATCAAGCCATACTCCTCTAGTGACCGA GAATTTCTGAAGGTAGCTGTGGAGCCTCCTTGGCCCCTAAACAGGGCCCCTCGCCGCGCC ACACCTCCAGCCCACCCACCCCCCCGCTCCAGCAGCCTGGGAAACTCACCAGAACGAGGT CCCCTCCGCCCCTTTGTGCCAGAGCAGGAGCTGCTGCGTTCCTTGCGCCTCTGCCCCCCA CACCCTACCGCCCGCCTTCTGTTGGCTGCTGACCCTGGGGGCAGCCCAGCTCAACGTCGT CGCACCAGG |
Restriction Sites | Please inquire |
ACCN | NM_024909 |
ORF Size | 972 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_024909.1, NP_079185.1 |
RefSeq Size | 2195 |
RefSeq ORF | 972 |
Locus ID | 79969 |
Gene Summary | This gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. This process may be important in microtubule growth, for instance during chemotaxis and the formation of cilium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (2) differs in the 5' and 3' UTRs and coding region compared to variant 1. The encoded isoform (2) has distinct N- and C-termini and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC327797 | ATAT1 (untagged)-Human chromosome 6 open reading frame 134 (C6orf134) transcript variant 2 |
USD 570.00 |
|
RC219108 | ATAT1 (Myc-DDK-tagged)-Human alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 2 |
USD 420.00 |
|
RC229162 | ATAT1 (Myc-DDK-tagged)-Human alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 2 |
USD 420.00 |
|
RG219108 | ATAT1 (GFP-tagged) - Human alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 2 |
USD 460.00 |
|
RG229162 | ATAT1 (GFP-tagged) - Human alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 2 |
USD 460.00 |
|
RC229162L1 | Lenti ORF clone of Human alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC229162L2 | Lenti ORF clone of Human alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC229162L3 | Lenti ORF clone of Human alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229162L4 | Lenti ORF clone of Human alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review