NSFL1C (NM_018839) Human Untagged Clone

CAT#: SC313017

NSFL1C (untagged)-Human NSFL1 (p97) cofactor (p47) (NSFL1C), transcript variant 2


  "NM_018839" in other vectors (4)

Reconstitution Protocol

USD 580.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NSFL1C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NSFL1C
Synonyms dJ776F14.1; P47; UBX1; UBXD10; UBXN2C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_018839, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGGAGCGACAGGAGGCGCTGAGGGAGTTCGTGGCGGTGACGGGCGCCGAGGAGGACCGGGCCC
GCTTCTTTCTCGAGTCGGCCGGCTGGGACTTGCAGATCGCGCTAGCGAGCTTTTATGAGGACGGAGGGGA
TGAAGACATTGTGACCATTTCGCAGGCAACCCCCAGTTCAGTGTCCAGAGGCACAGCCCCCAGTGATAAT
AGAGTGACATCCTTCAGAGACCTCATTCATGACCAAGATGAAGATGAGGAGGAAGAGGAAGGCCAGAGGT
TTTATGCTGGGGGCTCAGAGAGAAGTGGACAGCAGATTGTTGGCCCTCCCAGGAAGAAAAGTCCCAACGA
GCTGGTGGATGATCTCTTTAAAGGTGCCAAAGAGCATGGAGCTGTAGCTGTGGAGCGAGTGACCAAGAGC
CCTGGAGAGACCAGTAAACCGAGAGTTCATGTAGTATTGAAACTCTGGAAGAGTGGATTCAGCCTGGATA
ATGGAGAACTCAGAAGCTACCAAGACCCATCCAATGCCCAGTTTCTGGAGTCTATCCGCAGAGGGGAGGT
GCCAGCAGAGCTTCGGAGGCTAGCTCACGGTGGACAGGTGAACTTGGATATGGAGGACCATCGGGACGAG
GACTTTGTGAAGCCCAAAGGAGCCTTCAAAGCCTTCACTGGCGAGGGTCAGAAACTGGGCAGCACTGCCC
CCCAGGTGTTGAGTACCAGCTCTCCAGCCCAACAGGCAGAAAATGAAGCCAAAGCCAGCTCTTCCATCTT
AATCGACGAATCAGAGCCTACCACAAACATCCAAATTCGGCTTGCAGACGGCGGGAGGCTGGTGCAGAAA
TTTAACCACAGCCACAGGATCAGCGACATCCGACTCTTCATCGTGGATGCCCGGCCAGCCATGGCTGCCA
CCAGCTTTATCCTCATGACTACTTTCCCGAACAAAGAGCTGGCTGATGAGAGCCAGACCCTGAAGGAAGC
CAACCTGCTCAATGCTGTCATCGTGCAGCGGTTAACATAA


Restriction Sites SgfI-MluI     
ACCN NM_018839
ORF Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_018839.4, NP_061327.2
RefSeq Size 3475
RefSeq ORF 1020
Locus ID 55968
Domains UBX, FAF
Gene Summary N-ethylmaleimide-sensitive factor (NSF) and valosin-containing protein (p97) are two ATPases known to be involved in transport vesicle/target membrane fusion and fusions between membrane compartments. A trimer of the protein encoded by this gene binds a hexamer of cytosolic p97 and is required for p97-mediated regrowth of Golgi cisternae from mitotic Golgi fragments. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, May 2011]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.