Aprataxin (APTX) (NM_175073) Human Untagged Clone
CAT#: SC313032
APTX (untagged)-Human aprataxin (APTX), transcript variant 1
"NM_175073" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | APTX |
Synonyms | AOA; AOA1; AXA1; EAOH; EOAHA; FHA-HIT |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_175073, the custom clone sequence may differ by one or more nucleotides
ATGATGCGGGTGTGCTGGTTGGTGAGACAGGACAGCCGGCACCAGCGAATCAGACTTCCACATTTGGAAG CAGTTGTGATTGGGCGTGGCCCAGAGACCAAGATCACTGATAAGAAATGTTCTCGACAGCAAGTACAGTT GAAAGCAGAGTGTAACAAGGGATATGTCAAGGTAAAGCAGGTAGGAGTCAATCCCACCAGCATTGACTCA GTCGTAATTGGGAAGGACCAAGAGGTGAAGCTGCAGCCTGGCCAGGTTCTCCACATGGTGAATGAACTTT ATCCATATATTGTAGAGTTTGAGGAAGAGGCAAAGAACCCTGGCCTGGAAACACACAGGAAGAGAAAGAG ATCAGGCAACAGTGATTCTATAGAAAGGGATGCTGCTCAGGAAGCTGAGGCTGGGACAGGGCTGGAACCT GGGAGCAACTCTGGCCAATGCTCTGTGCCCCTAAAGAAGGGAAAAGATGCACCTATCAAAAAGGAATCCC TGGGCCACTGGAGTCAAGGCTTGAAGATTTCTATGCAGGACCCCAAAATGCAGGTTTACAAAGATGAGCA GGTGGTGGTGATAAAGGATAAATACCCAAAGGCCCGTTACCATTGGCTGGTCTTACCGTGGACCTCCATT TCCAGTCTGAAGGCTGTGGCCAGGGAACACCTTGAACTCCTTAAGCATATGCACACTGTGGGGGAAAAGG TGATTGTAGATTTTGCTGGGTCCAGCAAACTCCGCTTCCGATTGGGCTACCACGCCATTCCGAGTATGAG CCATGTACATCTTCATGTGATCAGCCAGGATTTTGATTCTCCTTGCCTTAAAAACAAAAAACATTGGAAT TCTTTCAATACAGAATACTTCCTAGAATCACAAGCTGTGATCGAGATGGTACAAGAGGCTGGTAGAGTAA CTGTCCGAGATGGGATGCCTGAGCTCTTGAAGCTGCCCCTTCGTTGTCATGAGTGCCAGCAGCTGCTGCC TTCCATTCCTCAGCTGAAAGAACATCTCAGGAAGCACTGGACACAGTGA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | Please inquire |
ACCN | NM_175073 |
ORF Size | 1029 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_175073.1, NP_778243.1 |
RefSeq Size | 2116 |
RefSeq ORF | 1029 |
Locus ID | 54840 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the histidine triad (HIT) superfamily. The encoded protein may play a role in single-stranded DNA repair through its nucleotide-binding activity and its diadenosine polyphosphate hydrolase activity. Mutations in this gene have been associated with ataxia-ocular apraxia. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (1) encodes isoform a. Variants 1, 6, 7, 16, 17, 18, and 19 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220799 | APTX (Myc-DDK-tagged)-Human aprataxin (APTX), transcript variant 1 |
USD 420.00 |
|
RG220799 | APTX (GFP-tagged) - Human aprataxin (APTX), transcript variant 1 |
USD 460.00 |
|
RC220799L3 | Lenti ORF clone of Human aprataxin (APTX), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC220799L4 | Lenti ORF clone of Human aprataxin (APTX), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review