OPCML (NM_002545) Human Untagged Clone

CAT#: SC313047

OPCML (untagged)-Human opioid binding protein/cell adhesion molecule-like (OPCML), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OPCML
• Synonyms: IGLON1; OBCAM; OPCM
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002545, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGGTCTGTGGGTACCTGTTCCTGCCCTGGAAGTGCCTCGTGGTCGTGTCTCTCAGGCTGCTGTTCC
  TTGTACCCACAGGAGTGCCCGTGCGCAGCGGAGATGCCACCTTCCCCAAAGCTATGGACAACGTGACGGT
  CCGGCAGGGGGAGAGCGCCACCCTCAGGTGTACCATAGATGACCGGGTAACCCGGGTGGCCTGGCTAAAC
  CGCAGCACCATCCTCTACGCTGGGAATGACAAGTGGTCCATAGACCCTCGTGTGATCATCCTGGTCAATA
  CACCAACCCAGTACAGCATCATGATCCAAAATGTGGATGTGTATGACGAAGGTCCGTACACCTGCTCTGT
  GCAGACAGACAATCATCCCAAAACGTCCCGGGTTCACCTAATAGTGCAAGTTCCTCCTCAGATCATGAAT
  ATCTCCTCAGACATCACTGTGAATGAGGGAAGCAGTGTGACCCTGCTGTGTCTTGCTATTGGCAGACCAG
  AGCCAACTGTGACATGGAGACACCTGTCAGTCAAGGAAGGCCAGGGCTTTGTAAGTGAGGATGAGTACCT
  GGAGATCTCTGACATCAAGCGAGACCAGTCCGGGGAGTACGAATGCAGCGCGTTGAACGATGTCGCTGCG
  CCCGATGTGCGGAAAGTAAAAATCACTGTAAACTATCCTCCCTATATCTCAAAAGCCAAGAACACTGGTG
  TTTCAGTCGGTCAGAAGGGCATCCTGAGCTGTGAAGCCTCTGCAGTCCCCATGGCTGAATTCCAGTGGTT
  CAAGGAAGAAACCAGGTTAGCCACTGGTCTGGATGGAATGAGGATTGAAAACAAAGGCCGCATGTCCACT
  CTGACTTTCTTCAATGTTTCAGAAAAGGATTATGGGAACTATACTTGTGTGGCCACGAACAAGCTTGGGA
  ACACCAATGCCAGCATCACATTGTATGGGCCTGGAGCAGTCATTGATGGTGTAAACTCGGCCTCCAGAGC
  ACTGGCTTGTCTCTGGCTATCAGGGACCCTCTTAGCCCACTTCTTCATCAAGTTTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002545
• ORF Size: 1038 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_002545.4, NP_002536.1
• RefSeq Size: 7111
• RefSeq ORF: 1038
• Locus ID: 4978
• Domains: ig, IGc2, IG
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
  Transcript Variant: This variant (1) lacks an alternate in-frame exon in the 3' coding region compared to variant 3. The encoded isoform (a) is shorter than isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.