hnRNP A2B1 (HNRNPA2B1) (NM_031243) Human Untagged Clone
CAT#: SC313092
HNRNPA2B1 (untagged)-Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1
"NM_031243" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HNRNPA2B1 |
Synonyms | HNRNPA2; HNRNPB1; HNRPA2; HNRPA2B1; HNRPB1; IBMPFD2; RNPA2; SNRPB1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_031243 edited
ATGGAGAAAACTTTAGAAACTGTTCCTTTGGAGAGGAAAAAGAGAGAAAAGGAACAGTTC CGTAAGCTCTTTATTGGTGGCTTAAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTAC TACGAACAATGGGGAAAGCTTACAGACTGTGTGGTAATGAGGGATCCTGCAAGCAAAAGA TCAAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTTGATGCTGCCATGGCT GCAAGACCTCATTCAATTGATGGGAGAGTAGTTGAGCCAAAACGTGCTGTAGCAAGAGAG GAATCTGGAAAACCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGCGGAATTAAA GAAGATACTGAGGAACATCACCTTAGAGATTACTTTGAGGAATATGGAAAAATTGATACC ATTGAGATAATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGCTTTGTTACTTTT GATGACCATGATCCTGTGGATAAAATCGTATTGCAGAAATACCATACCATCAATGGTCAT AATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAAATGCAGGAAGTTCAGAGTTCTAGG AGTGGAAGAGGAGGCAACTTTGGCTTTGGGGATTCACGTGGTGGCGGTGGAAATTTCGGA CCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGATATGGCAGTGGACGTGGATTT GGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCC GGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGT GGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTAC AATGATTTTGGAAATTATAACCAGCAACCTTCTAACTACGGTCCAATGAAGAGTGGAAAC TTTGGTGGTAGCAGGAACATGGGGGGACCATATGGTGGAGGAAACTATGGTCCAGGAGGC AGTGGAGGAAGTGGGGGTTATGGTGGGAGGAGCCGATACTGA |
Restriction Sites | Please inquire |
ACCN | NM_031243 |
Insert Size | 1600 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_031243.1, NP_112533.1 |
RefSeq Size | 1780 bp |
RefSeq ORF | 1062 bp |
Locus ID | 3181 |
Cytogenetics | 7p15.2 |
Domains | RRM |
Protein Families | Druggable Genome |
Gene Summary | 'This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. This gene has been described to generate two alternatively spliced transcript variants which encode different isoforms. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (B1) contains an additional 36 bases compared to variant A2. This additional region affects only the beginning of the coding region. The N-terminus of isoform B1 is thus different from isoform A2. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224241 | HNRNPA2B1 (Myc-DDK-tagged)-Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1 |
USD 420.00 |
|
RG224241 | HNRNPA2B1 (GFP-tagged) - Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1 |
USD 460.00 |
|
RC224241L1 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1, Myc-DDK-tagged |
USD 768.00 |
|
RC224241L2 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1, mGFP tagged |
USD 620.00 |
|
RC224241L3 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1, Myc-DDK-tagged |
USD 620.00 |
|
RC224241L4 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review