RFC2 (NM_181471) Human Untagged Clone
CAT#: SC313100
RFC2 (untagged)-Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1
"NM_181471" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RFC2 |
Synonyms | RFC40 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_181471, the custom clone sequence may differ by one or more nucleotides
ATGGAGGTGGAGGCCGTCTGTGGTGGCGCGGGCGAGGTGGAGGCCCAGGACTCTGACCCTGCCCCTGCCT TCAGCAAGGCCCCCGGCAGCGCCGGCCACTACGAACTGCCGTGGGTTGAAAAATATAGGCCAGTAAAGCT GAATGAAATTGTCGGGAATGAAGACACCGTGAGCAGGCTAGAGGTCTTTGCAAGGGAAGGAAATGTGCCC AACATCATCATTGCGGGCCCTCCAGGAACCGGCAAGACCACAAGCATTCTGTGCTTGGCCCGGGCCCTGC TGGGCCCAGCACTCAAAGATGCCATGTTGGAACTCAATGCTTCAAATGACAGGGGCATTGACGTTGTGAG GAATAAAATTAAAATGTTTGCTCAACAAAAAGTCACTCTTCCCAAAGGCCGACATAAGATCATCATTCTG GATGAAGCAGACAGCATGACCGACGGAGCCCAGCAAGCCTTGAGGAGAACCATGGAAATCTACTCTAAAA CCACTCGCTTCGCCCTTGCTTGTAATGCTTCGGATAAGATCATCGAGCCCATTCAGTCCCGCTGTGCAGT CCTCCGGTACACAAAGCTGACCGACGCCCAGATCCTCACCAGGCTGATGAATGTTATCGAGAAGGAGAGG GTACCCTACACTGATGACGGCCTAGAAGCCATCATCTTCACGGCCCAGGGAGACATGAGGCAGGCGCTGA ACAACCTGCAGTCCACCTTCTCAGGATTTGGCTTCATTAACAGTGAGAACGTGTTCAAGGTCTGTGACGA GCCCCACCCACTGCTGGTAAAGGAGATGATCCAGCACTGTGTGAATGCCAACATTGACGAAGCCTACAAG ATTCTTGCTCACTTGTGGCATCTGGGCTACTCACCAGAAGATATCATTGGCAACATCTTTCGAGTGTGTA AAACTTTCCAAATGGCAGAATACCTGAAACTGGAGTTTATCAAGGAAATTGGATACACTCACATGAAAAT AGCGGAAGGAGTGAACTCTCTTTTGCAGATGGCAGGCCTCCTGGCAAGGCTGTGTCAGAAGACAATGGCC CCGGTGGCCAGTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_181471 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181471.2, NP_852136.1 |
RefSeq Size | 1759 bp |
RefSeq ORF | 1065 bp |
Locus ID | 5982 |
Cytogenetics | 7q11.23 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | DNA replication, Mismatch repair, Nucleotide excision repair |
Gene Summary | 'This gene encodes a member of the activator 1 small subunits family. The elongation of primed DNA templates by DNA polymerase delta and epsilon requires the action of the accessory proteins, proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). Replication factor C, also called activator 1, is a protein complex consisting of five distinct subunits. This gene encodes the 40 kD subunit, which has been shown to be responsible for binding ATP and may help promote cell survival. Disruption of this gene is associated with Williams syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene of this gene has been defined on chromosome 2. [provided by RefSeq, Jul 2013]' Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220036 | RFC2 (Myc-DDK-tagged)-Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1 |
USD 420.00 |
|
RG220036 | RFC2 (GFP-tagged) - Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1 |
USD 460.00 |
|
RC220036L3 | Lenti ORF clone of Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC220036L4 | Lenti ORF clone of Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review