FBXO25 (NM_183420) Human Untagged Clone

CAT#: SC313116

FBXO25 (untagged)-Human F-box protein 25 (FBXO25), transcript variant 2


  "NM_183420" in other vectors (4)

Reconstitution Protocol

USD 610.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FBXO25"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FBXO25
Synonyms FBX25
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_183420, the custom clone sequence may differ by one or more nucleotides


ATGCCATTTTTGGGTCAGGACTGGAGATCTCCTGGATGGAGTTGGATTAAGACAGAAGATGGCTGGAAGA
GATGTGAATCTTGTAGTCAGAAACTTGAAAGAGAGAATAACCGTTGTAACATCAGTCACAGCATTATCTT
AAATAGTGAAGATGGAGAAATATTCAATAATGAAGAGCATGAATATGCATCGAAAAAAAGGAAAAAGGAC
CATTTTAGAAATGACACAAATACTCAAAGTTTTTATCGTGAAAAATGGATCTATGTCCATAAAGAAAGCA
CAAAGGAAAGGCATGGCTATTGCACCTTGGGAGAAGCCTTTAATCGGTTAGACTTCTCAAGTGCAATTCA
AGATATCCGAAGGTTCAATTATGTGGTCAAACTGTTGCAGCTAATTGCAAAATCCCAGTTAACTTCATTG
AGTGGCGTGGCACAGAAGAATTACTTCAACATTTTGGATAAAATCGTTCAAAAGGTTCTTGATGACCACC
ACAATCCTCGCTTAATCAAAGATCTTCTGCAAGACCTAAGCTCTACCCTCTGCATTCTTATTAGAGGAGT
AGGGAAGTCTGTATTAGTGGGAAACATCAATATTTGGATTTGCCGATTAGAAACTATTCTCGCCTGGCAA
CAACAGCTACAGGATCTTCAGATGACTAAGCAAGTGAACAATGGCCTCACCCTCAGTGACCTTCCTCTGC
ACATGCTGAACAACATCCTATACCGGTTCTCAGACGGATGGGACATCATCACCTTAGGCCAGGTGACCCC
CACGTTGTATATGCTTAGTGAAGACAGACAGCTGTGGAAGAAGCTTTGTCAGTACCATTTTGCTGAAAAG
CAGTTTTGTAGACATTTGATCCTTTCAGAAAAAGGTCATATTGAATGGAAGTTGATGTACTTTGCACTTC
AGAAACATTACCCAGCGAAGGAGCAGTACGGAGACACACTGCATTTCTGTCGGCACTGCAGCATTCTCTT
TTGGAAGGACTCAGGACACCCCTGCACGGCGGCCGACCCTGACAGCTGCTTCACGCCTGTGTCTCCGCAG
CACTTCATCGACCTCTTCAAGTTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_183420
ORF Size 1077 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_183420.1, NP_904356.1
RefSeq Size 2502
RefSeq ORF 1077
Locus ID 26260
Gene Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, as compared to variant 1. The encoded isoform (2) is missing an internal segment, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.