CD46 (NM_172352) Human Untagged Clone

CAT#: SC313135

CD46 (untagged)-Human CD46 molecule, complement regulatory protein (CD46), transcript variant e

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD46
• Synonyms: AHUS2; MCP; MIC10; TLX; TRA2.10
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_172352, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCTCCCGGCCGCCGCGAGTGTCCCTTTCCTTCCTGGCGCTTTCCTGGGTTGCTTCTGGCGGCCA
  TGGTGTTGCTGCTGTACTCCTTCTCCGATGCCTGTGAGGAGCCACCAACATTTGAAGCTATGGAGCTCAT
  TGGTAAACCAAAACCCTACTATGAGATTGGTGAACGAGTAGATTATAAGTGTAAAAAAGGATACTTCTAT
  ATACCTCCTCTTGCCACCCATACTATTTGTGATCGGAATCATACATGGCTACCTGTCTCAGATGACGCCT
  GTTATAGAGAAACATGTCCATATATACGGGATCCTTTAAATGGCCAAGCAGTCCCTGCAAATGGGACTTA
  CGAGTTTGGTTATCAGATGCACTTTATTTGTAATGAGGGTTATTACTTAATTGGTGAAGAAATTCTATAT
  TGTGAACTTAAAGGATCAGTAGCAATTTGGAGCGGTAAGCCCCCAATATGTGAAAAGGTTTTGTGTACAC
  CACCTCCAAAAATAAAAAATGGAAAACACACCTTTAGTGAAGTAGAAGTATTTGAGTATCTTGATGCAGT
  AACTTATAGTTGTGATCCTGCACCTGGACCAGATCCATTTTCACTTATTGGAGAGAGCACGATTTATTGT
  GGTGACAATTCAGTGTGGAGTCGTGCTGCTCCAGAGTGTAAAGTGGTCAAATGTCGATTTCCAGTAGTCG
  AAAATGGAAAACAGATATCAGGATTTGGAAAAAAATTTTACTACAAAGCAACAGTTATGTTTGAATGCGA
  TAAGGGTTTTTACCTCGATGGCAGCGACACAATTGTCTGTGACAGTAACAGTACTTGGGATCCCCCAGTT
  CCAAAGTGTCTTAAAGGTCCTAGGCCTACTTACAAGCCTCCAGTCTCAAATTATCCAGGATATCCTAAAC
  CTGAGGAAGGAATACTTGACAGTTTGGATGTTTGGGTCATTGCTGTGATTGTTATTGCCATAGTTGTTGG
  AGTTGCAGTAATTTGTGTTGTCCCGTACAGATATCTTCAAAGGAGGAAGAAGAAAGGCACATACCTAACT
  GATGAGACCCACAGAGAAGTAAAATTTACTTCTCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_172352
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_172352.2, NP_758862.1
• RefSeq Size: 3312 bp
• RefSeq ORF: 1089 bp
• Locus ID: 4179
• Cytogenetics: 1q32.2
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Complement and coagulation cascades
• Gene Summary: 'The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]'
  Transcript Variant: This variant (e) lacks an alternate in-frame segment compared to variant a, resulting in a shorter isoform (5) compared to isoform 1.