IL6R (NM_181359) Human Untagged Clone

CAT#: SC313146

IL6R (untagged)-Human interleukin 6 receptor (IL6R), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL6R
• Synonyms: CD126; gp80; IL-6R-1; IL-6RA; IL6Q; IL6RA; IL6RQ
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181359, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGGCCGTCGGCTGCGCGCTGCTGGCTGCCCTGCTGGCCGCGCCGGGAGCGGCGCTGGCCCCAAGGC
  GCTGCCCTGCGCAGGAGGTGGCGAGAGGCGTGCTGACCAGTCTGCCAGGAGACAGCGTGACTCTGACCTG
  CCCGGGGGTAGAGCCGGAAGACAATGCCACTGTTCACTGGGTGCTCAGGAAGCCGGCTGCAGGCTCCCAC
  CCCAGCAGATGGGCTGGCATGGGAAGGAGGCTGCTGCTGAGGTCGGTGCAGCTCCACGACTCTGGAAACT
  ATTCATGCTACCGGGCCGGCCGCCCAGCTGGGACTGTGCACTTGCTGGTGGATGTTCCCCCCGAGGAGCC
  CCAGCTCTCCTGCTTCCGGAAGAGCCCCCTCAGCAATGTTGTTTGTGAGTGGGGTCCTCGGAGCACCCCA
  TCCCTGACGACAAAGGCTGTGCTCTTGGTGAGGAAGTTTCAGAACAGTCCGGCCGAAGACTTCCAGGAGC
  CGTGCCAGTATTCCCAGGAGTCCCAGAAGTTCTCCTGCCAGTTAGCAGTCCCGGAGGGAGACAGCTCTTT
  CTACATAGTGTCCATGTGCGTCGCCAGTAGTGTCGGGAGCAAGTTCAGCAAAACTCAAACCTTTCAGGGT
  TGTGGAATCTTGCAGCCTGATCCGCCTGCCAACATCACAGTCACTGCCGTGGCCAGAAACCCCCGCTGGC
  TCAGTGTCACCTGGCAAGACCCCCACTCCTGGAACTCATCTTTCTACAGACTACGGTTTGAGCTCAGATA
  TCGGGCTGAACGGTCAAAGACATTCACAACATGGATGGTCAAGGACCTCCAGCATCACTGTGTCATCCAC
  GACGCCTGGAGCGGCCTGAGGCACGTGGTGCAGCTTCGTGCCCAGGAGGAGTTCGGGCAAGGCGAGTGGA
  GCGAGTGGAGCCCGGAGGCCATGGGCACGCCTTGGACAGAATCCAGGAGTCCTCCAGCTGAGAACGAGGT
  GTCCACCCCCATGCAGGCACTTACTACTAATAAAGACGATGATAATATTCTCTTCAGAGATTCTGCAAAT
  GCGACAAGCCTCCCAGGTTCAAGAAGACGTGGAAGCTGCGGGCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_181359
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_181359.2, NP_852004.1
• RefSeq Size: 5834 bp
• RefSeq ORF: 1098 bp
• Locus ID: 3570
• Cytogenetics: 1q21.3
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
• Gene Summary: 'This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been identified in this gene. A pseudogene of this gene is found on chromosome 9. [provided by RefSeq, Aug 2020]'
  Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting isoform (2) has a distinct C-terminus and is shorter than isoform 1.