NDRG4 (NM_022910) Human Untagged Clone

CAT#: SC313177

NDRG4 (untagged)-Human NDRG family member 4 (NDRG4), transcript variant 3


  "NM_022910" in other vectors (4)

Reconstitution Protocol

USD 640.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NDRG4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NDRG4
Synonyms BDM1; SMAP-8; SMAP8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_022910, the custom clone sequence may differ by one or more nucleotides


ATGGCCGGGCTGCAGGAGCTGCGATTCCCTGAGGAGAAGCCGCTGCTCCGGGGCCAGGACGCCACCGAGC
TGGAGAGCTCCGATGCCTTCCTCTTGGCTGCAGACACAGACTGGAAGGAACATGACATCGAGACACCCTA
CGGCCTTCTGCATGTAGTGATCCGGGGCTCCCCCAAGGGGAACCGCCCAGCCATCCTCACCTACCATGAT
GTGGGCCTCAACCACAAACTATGCTTCAACACCTTCTTCAACTTCGAGGACATGCAGGAGATCACCAAGC
ACTTTGTGGTGTGTCACGTGGATGCCCCTGGACAACAGGTGGGGGCGTCGCAGTTTCCTCAGGGGTACCA
GTTCCCCTCCATGGAGCAGCTGGCTGCCATGCTCCCCAGCGTGGTGCAGCATTTCGGGTTCAAGTATGTG
ATTGGCATCGGAGTGGGCGCCGGAGCCTATGTGCTGGCCAAGTTTGCACTCATCTTCCCCGACCTGGTGG
AGGGGCTGGTGCTGGTGAACATCGACCCCAATGGCAAAGGCTGGATAGACTGGGCTGCCACCAAGCTCTC
CGGCCTAACTAGCACTTTACCCGACACGGTGCTCTCCCACCTCTTCAGCCAGGAGGAGCTGGTGAACAAC
ACAGAGTTGGTGCAGAGCTACCGGCAGCAGATTGGGAACGTGGTGAACCAGGCCAACCTGCAGCTCTTCT
GGAACATGTACAACAGCCGCAGAGACCTGGACATTAACCGGCCTGGAACGGTGCCCAATGCCAAGACGCT
CCGCTGCCCCGTGATGCTGGTGGTTGGGGATAATGCACCCGCTGAGGACGGGGTGGTGGAGTGCAACTCC
AAACTGGACCCGACCACTACGACCTTCCTGAAGATGGCAGACTCTGGAGGGCTGCCCCAGGTCACACAGC
CAGGGAAGCTGACTGAAGCCTTCAAATACTTCCTGCAAGGCATGGGCTACATGCCCTCAGCCAGCATGAC
CCGCCTGGCACGCTCCCGCACTGCATCCCTCACCAGTGCCAGCTCGGTGGATGGCAGCCGCCCACAGGCC
TGCACCCACTCAGAGAGCAGCGAGGGGCTGGGCCAGGTCAACCACACCATGGAGGTGTCCTGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_022910
ORF Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_022910.3, NP_075061.1
RefSeq Size 3453
RefSeq ORF 1116
Locus ID 65009
Domains Ndr
Gene Summary This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that is required for cell cycle progression and survival in primary astrocytes and may be involved in the regulation of mitogenic signalling in vascular smooth muscles cells. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (3) differs in the 5' UTR which results in the use of an in-frame downstream translation initiation codon, compared to variant 2. The encoded protein (isoform 1; also known as NDRG4-H) has a shorter N-terminus, compared to isoform 2. Variants 1 and 3 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.