SERPINB8 (NM_002640) Human Untagged Clone

CAT#: SC313190

SERPINB8 (untagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SERPINB8
• Synonyms: C18orf53; CAP2; PI-8; PI8; PSS5
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_002640 edited
  ATGGATGACCTCTGTGAAGCAAATGGCACTTTTGCCATCAGCTTATTTAAAATATTGGGG
  GAAGAGGACAACTCAAGAAACGTATTCTTCTCTCCCATGAGCATCTCCTCTGCCCTGGCC
  ATGGTCTTCATGGGGGCAAAGGGAAGCACTGCAGCCCAGATGTCCCAGGCACTTTGTTTA
  TACAAAGACGGAGATATTCACCGAGGTTTCCAGTCACTTCTCAGTGAAGTTAACAGAACT
  GGCACTCAGTACTTGCTTAGAACTGCCAACAGACTCTTTGGAGAAAAGACGTGTGATTTC
  CTTCCAGACTTTAAAGAATACTGTCAGAAGTTCTATCAGGCAGAGCTGGAGGAGTTGTCC
  TTTGCTGAAGACACTGAAGAGTGCAGGAAGCATATAAATGACTGGGTGGCAGAGAAGACT
  GAAGGTAAGATTTCAGAGGTACTGGATGCTGGGACAGTCGATCCCCTGACAAAGCTAGTC
  CTTGTGAATGCCATTTATTTCAAGGGAAAGTGGAATGAGCAATTTGACAGAAAGTACACA
  AGGGGAATGCTCTTTAAAACCAACGAGGAAAAAAAGACAGTGCAGATGATGTTTAAGGAA
  GCTAAGTTTAAAATGGGGTATGCGGATGAGGTACACACCCAGGTCCTGGAGCTGCCCTAT
  GTGGAAGAGGAGCTGAGCATGGTCATTCTGCTTCCCGATGACAACACGGACCTCGCCGTG
  GTGGAAAAAGCACTTACATATGAGAAATTCAAAGCCTGGACAAATTCAGAAAAGTTGACA
  AAAAGTAAGGTTCAAGTTTTCCTTCCCAGATTAAAGCTGGAGGAGAGTTATGACTTGGAG
  CCTTTCCTTCGAAGATTAGGAATGATCGATGCTTTTGACGAAGCCAAGGCAGACTTTTCT
  GGAATGTCAACTGAGAAGAATGTGCCTCTGTCCAAGGTTGCTCACAAGTGCTTCGTGGAG
  GTCAATGAGGAAGGCACAGAGGCTGCCGCAGCCACTGCTGTGGTCAGGAATTCCCGGTGC
  AGCAGAATGGAGCCAAGATTCTGTGCAGACCACCCTTTTCTTTTCTTCATCAGGCGCCAC
  AAAACCAACTGCATCTTGTTCTGTGGCAGGTTCTCTTCTCCGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_002640
• Insert Size: 3600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002640.3, NP_002631.3
• RefSeq Size: 3390 bp
• RefSeq ORF: 1125 bp
• Locus ID: 5271
• Cytogenetics: 18q22.1
• Domains: SERPIN
• Protein Families: Druggable Genome
• Gene Summary: 'The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017]'
  Transcript Variant: This variant (1) uses an alternate splice junction in the 5' UTR compared to variant 2. Variants 1, 2 and 10 encode the same isoform (a).