FANCF (NM_022725) Human Untagged Clone
CAT#: SC313192
FANCF (untagged)-Human Fanconi anemia, complementation group F (FANCF)
"NM_022725" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FANCF |
Synonyms | FAF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_022725, the custom clone sequence may differ by one or more nucleotides
ATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCA GCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCG CTTTGGTCGGCATGGCCCCATTCGCACGGCTCTGGAGCGGCGGCTGCACAACCAGTGGAGGCAAGAGGGC GGCTTTGGGCGGGGTCCAGTTCCGGGATTAGCGAACTTCCAGGCCCTCGGTCACTGTGACGTCCTGCTCT CTCTGCGCCTGCTGGAGAACCGGGCCCTCGGGGATGCAGCTCGTTACCACCTGGTGCAGCAACTCTTTCC CGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAGCCTGGCCCGCCTTGCCCGCCGGCGG TCTGCGGTGCACATGCTGCGCTTCAATGGCTATAGAGAGAACCCAAATCTCCAGGAGGACTCTCTGATGA AGACCCAGGCGGAGCTGCTGCTGGAGCGTCTGCAGGAGGTGGGGAAGGCCGAAGCGGAGCGTCCCGCCAG GTTTCTCAGCAGCCTGTGGGAGCGCTTGCCTCAGAACAACTTCCTGAAGGTGATAGCGGTGGCGCTGTTG CAGCCGCCTTTGTCTCGTCGGCCCCAAGAAGAGTTGGAACCCGGCATCCACAAATCACCTGGAGAGGGGA GCCAAGTGCTAGTCCACTGGCTTCTGGGGAATTCGGAAGTCTTTGCTGCCTTTTGTCGCGCCCTCCCAGC CGGGCTTTTGACTTTAGTGACTAGCCGCCACCCAGCGCTGTCTCCTGTCTATCTGGGTCTGCTAACAGAC TGGGGTCAACGTTTGCACTATGACCTTCAGAAAGGCATTTGGGTTGGAACTGAGTCCCAAGATGTGCCCT GGGAGGAGTTGCACAATAGGTTTCAAAGCCTCTGTCAGGCCCCTCCACCTCTGAAAGATAAAGTTCTAAC TGCCCTGGAGACCTGTAAAGCGCAGGATGGAGATTTTGAAGTACCTGGTCTTAGCATCTGGACAGACCTC TTATTAGCTCTTCGTAGTGGTGCATTTAGGAAAAGACAAGTTTTGGGTCTCAGCGCAGGCCTCAGTTCTG TATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_022725 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022725.3, NP_073562.1 |
RefSeq Size | 3309 bp |
RefSeq ORF | 1125 bp |
Locus ID | 2188 |
Cytogenetics | 11p14.3 |
Protein Families | Druggable Genome |
Gene Summary | 'The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group F. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208920 | FANCF (Myc-DDK-tagged)-Human Fanconi anemia, complementation group F (FANCF) |
USD 420.00 |
|
RG208920 | FANCF (GFP-tagged) - Human Fanconi anemia, complementation group F (FANCF) |
USD 460.00 |
|
RC208920L1 | Lenti ORF clone of Human Fanconi anemia, complementation group F (FANCF), Myc-DDK-tagged |
USD 768.00 |
|
RC208920L2 | Lenti ORF clone of Human Fanconi anemia, complementation group F (FANCF), mGFP tagged |
USD 620.00 |
|
RC208920L3 | Lenti ORF clone of Human Fanconi anemia, complementation group F (FANCF), Myc-DDK-tagged |
USD 620.00 |
|
RC208920L4 | Lenti ORF clone of Human Fanconi anemia, complementation group F (FANCF), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review