NPY4R (NM_005972) Human Untagged Clone

CAT#: SC313198

PPYR1 (untagged)-Human pancreatic polypeptide receptor 1 (PPYR1)


  "NM_005972" in other vectors (6)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "NPY4R"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NPY4R
Synonyms NPY4-R; PP1; PPYR1; Y4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_005972, the custom clone sequence may differ by one or more nucleotides
ATGAACACCTCTCACCTCCTGGCCTTGCTGCTCCCAAAATCTCCACAAGGTGAAAACAGA
AGCAAACCCCTGGGCACCCCATACAACTTCTCTGAACATTGCCAGGATTCCGTGGACGTG
ATGGTCTTCATCGTCACTTCCTACAGCATTGAGACTGTCGTGGGGGTCCTGGGTAACCTC
TGCCTGATGTGTGTGACTGTGAGGCAGAAGGAGAAAGCCAACGTGACCAACCTGCTTATC
GCCAACCTGGCCTTCTCTGACTTCCTCATGTGCCTCCTCTGCCAGCCGCTGACCTCCGTC
TACACCATCATGGACTACTGGATCTTTGGAGAGACCCTCTGCAAGATGTCGGCCTTCATC
CAGTGCATGTCGGTGACGGTCTCCATCCTCTCGCTCGTCCTCGTGGCCCTGGAGAGGCAT
CAGCTCATCATCAACCCAACAGGCTGGAAGCCCAGCATCTCACAGGCCTACCTGGGGATT
GTGCTCATCTGGGTCATTGCCTGTGTCCTCTCCCTGCCCTTCCTGGCCAACAGCATCCTG
GAGAATGTCTTCCACAAGAACCACTCCAAGGCTCTGGAGTTCCTGGCGGATAAGGTGGTC
TGTACCGAGTCCTGGCCACTGGCTCACCACCGCACCATCTACACCACCTTCCTGCTCCTC
TTCCAGTACTGCCTCCCACTGGGCTTCATCTTGGTCTGTTATGCACGCATCTACCGGCGC
CTGCAGAGGCAGGGGCGCGTGTTTCACAAGGGCACCTACAGCTTGCGAGCTGGGCACATG
AAGCAGGTCAATGTGGTGCTGGTGGTGATGGTGGTGGCCTTTGCCGTGCTCTGGCTGCCT
CTGCATGTGTTCAACAGCCTGGAAGACTGGCACCATGAGGCCATCCCCATCTGCCATGGG
AACCTCATCTTCTTAGTGTGCCACTTGCTTGCCATGGCCTCCACCTGTGTCAACCCATTC
ATCTATGGCTTTCTCAACACCAACTTCAAGAAGGAGATCAAGGCCCTGGTGCTGACTTGC
CAGCAGAGCGCCCCCCTGGAGGAGTCAGAGCATCTGCCCCTGTCCACAGTACATACGGAA
GTCTCCAAAGGGTCCCTGAGGCTAAGTGGCAGGTCCAATCCCATT
Restriction Sites Please inquire     
ACCN NM_005972
Insert Size 4700 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005972.3, NP_005963.2
RefSeq Size 1956 bp
RefSeq ORF 1128 bp
Locus ID 5540
Cytogenetics 10q11.22
Domains 7tm_1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary ''
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.