NPY4R (NM_005972) Human Untagged Clone

CAT#: SC313198

PPYR1 (untagged)-Human pancreatic polypeptide receptor 1 (PPYR1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NPY4R
• Synonyms: NPY4-R; PP1; PPYR1; Y4
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005972, the custom clone sequence may differ by one or more nucleotides
  ATGAACACCTCTCACCTCCTGGCCTTGCTGCTCCCAAAATCTCCACAAGGTGAAAACAGA
  AGCAAACCCCTGGGCACCCCATACAACTTCTCTGAACATTGCCAGGATTCCGTGGACGTG
  ATGGTCTTCATCGTCACTTCCTACAGCATTGAGACTGTCGTGGGGGTCCTGGGTAACCTC
  TGCCTGATGTGTGTGACTGTGAGGCAGAAGGAGAAAGCCAACGTGACCAACCTGCTTATC
  GCCAACCTGGCCTTCTCTGACTTCCTCATGTGCCTCCTCTGCCAGCCGCTGACCTCCGTC
  TACACCATCATGGACTACTGGATCTTTGGAGAGACCCTCTGCAAGATGTCGGCCTTCATC
  CAGTGCATGTCGGTGACGGTCTCCATCCTCTCGCTCGTCCTCGTGGCCCTGGAGAGGCAT
  CAGCTCATCATCAACCCAACAGGCTGGAAGCCCAGCATCTCACAGGCCTACCTGGGGATT
  GTGCTCATCTGGGTCATTGCCTGTGTCCTCTCCCTGCCCTTCCTGGCCAACAGCATCCTG
  GAGAATGTCTTCCACAAGAACCACTCCAAGGCTCTGGAGTTCCTGGCGGATAAGGTGGTC
  TGTACCGAGTCCTGGCCACTGGCTCACCACCGCACCATCTACACCACCTTCCTGCTCCTC
  TTCCAGTACTGCCTCCCACTGGGCTTCATCTTGGTCTGTTATGCACGCATCTACCGGCGC
  CTGCAGAGGCAGGGGCGCGTGTTTCACAAGGGCACCTACAGCTTGCGAGCTGGGCACATG
  AAGCAGGTCAATGTGGTGCTGGTGGTGATGGTGGTGGCCTTTGCCGTGCTCTGGCTGCCT
  CTGCATGTGTTCAACAGCCTGGAAGACTGGCACCATGAGGCCATCCCCATCTGCCATGGG
  AACCTCATCTTCTTAGTGTGCCACTTGCTTGCCATGGCCTCCACCTGTGTCAACCCATTC
  ATCTATGGCTTTCTCAACACCAACTTCAAGAAGGAGATCAAGGCCCTGGTGCTGACTTGC
  CAGCAGAGCGCCCCCCTGGAGGAGTCAGAGCATCTGCCCCTGTCCACAGTACATACGGAA
  GTCTCCAAAGGGTCCCTGAGGCTAAGTGGCAGGTCCAATCCCATT
  
• Restriction Sites: Please inquire
• ACCN: NM_005972
• Insert Size: 4700 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005972.3, NP_005963.2
• RefSeq Size: 1956 bp
• RefSeq ORF: 1128 bp
• Locus ID: 5540
• Cytogenetics: 10q11.22
• Domains: 7tm_1
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• Gene Summary: ''
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.