GM CSF Receptor alpha (CSF2RA) (NM_172246) Human Untagged Clone
CAT#: SC313212
CSF2RA (untagged)-Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 3
"NM_172246" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CSF2RA |
Synonyms | alphaGMR; CD116; CDw116; CSF2R; CSF2RAX; CSF2RAY; CSF2RX; CSF2RY; GM-CSF-R-alpha; GMCSFR; GMR; SMDP4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_172246, the custom clone sequence may differ by one or more nucleotides
ATGCTTCTCCTGGTGACAAGCCTTCTGCTCTGTGAGTTACCACACCCAGCATTCCTCCTGATCCCAGAGA AATCGGATCTGCGAACAGTGGCACCAGCCTCTAGTCTCAATGTGAGGTTTGACTCCAGGACGATGAATTT AAGCTGGGACTGCCAAGAAAACACAACCTTCAGCAAGTGTTTCTTAACTGACAAGAAGAACAGAGTCGTG GAACCCAGGCTCAGTAACAACGAATGTTCGTGCACATTTCGTGAAATTTGTCTGCATGAAGGAGTCACAT TTGAGGTTCACGTGAATACTAGTCAAAGAGGATTTCAACAGAAACTGCTTTATCCAAATTCAGGAAGGGA GGGTACCGCTGCTCAGAATTTCTCCTGTTTCATCTACAATGCGGATTTAATGAACTGTACCTGGGCGAGG GGTCCGACGGCCCCCCGTGACGTCCAGTATTTTTTGTACATACGAAACTCAAAGAGAAGGAGGGAGATCC GGTGTCCTTATTACATACAAGACTCAGGAACCCATGTGGGATGTCACCTGGATAACCTGTCAGGATTAAC GTCTCGCAATTACTTTCTGGTTAACGGAACCAGCCGAGAAATTGGCATCCAATTCTTTGATTCACTTTTG GACACAAAGAAAATAGAACGATTCAACCCTCCCAGCAATGTCACCGTACGTTGCAACACGACGCACTGCC TCGTACGGTGGAAACAGCCCAGGACCTATCAGAAGCTGTCGTACCTGGACTTTCAGTACCAGCTGGACGT CCACAGAAAGAATACCCAGCCTGGCACGGAAAACCTACTGATTAATGTTTCTGGTGATTTGGAAAATAGA TACAACTTTCCAAGCTCTGAGCCCAGAGCAAAACACAGTGTGAAGATCAGAGCTGCAGACGTCCGCATCT TGAATTGGAGCTCCTGGAGTGAAGCCATTGAATTTGATCATCTGGGAGGAATTCACCCCAGAGGAAGGGA AAGGCTACCGCGAAGAGGTCTTGACCGTGAAGGAAATTACCTGAGACCCAGAGGGTGTAGGAATGGCATG GACATCTCCGCCTCCGCGACACGGGGGAACTGTTTTCTTGATGATGCTGTGAACCTTTATATCATTTTCT ATGTTTTTATTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_172246 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_172246.2, NP_758449.1 |
RefSeq Size | 1676 bp |
RefSeq ORF | 1134 bp |
Locus ID | 1438 |
Cytogenetics | X;Y |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway, Pathways in cancer |
Gene Summary | 'The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (3) lacks two coding exons in the 3' region, which causes a frameshift, compared to variant 1. The resulting isoform (b), which is likely soluble, is shorter and has a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220289 | CSF2RA (Myc-DDK-tagged)-Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 3 |
USD 420.00 |
|
RG220289 | CSF2RA (GFP-tagged) - Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 3 |
USD 460.00 |
|
RC220289L3 | Lenti-ORF clone of CSF2RA (Myc-DDK-tagged)-Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 3 |
USD 620.00 |
|
RC220289L4 | Lenti-ORF clone of CSF2RA (mGFP-tagged)-Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review