DAZAP1 (NM_170711) Human Untagged Clone

CAT#: SC313219

DAZAP1 (untagged)-Human DAZ associated protein 1 (DAZAP1), transcript variant 1


  "NM_170711" in other vectors (4)

Reconstitution Protocol

USD 650.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DAZAP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DAZAP1
Synonyms MGC19907
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_170711, the custom clone sequence may differ by one or more nucleotides


ATGAACAACTCGGGCGCCGACGAGATCGGGAAGCTCTTCGTGGGCGGTCTTGACTGGAGCACGACCCAAG
AGACTCTGCGCAGCTACTTTTCCCAATATGGAGAAGTCGTAGATTGTGTTATCATGAAAGATAAAACCAC
CAACCAGTCTCGAGGCTTTGGGTTTGTCAAATTTAAAGACCCAAACTGTGTGGGGACGGTGCTGGCCAGC
AGACCGCACACGCTAGATGGCCGAAACATCGACCCCAAGCCATGCACACCCCGGGGGATGCAGCCGGAGA
GAACACGGCCGAAGGAAGGATGGCAGAAAGGACCCAGGAGCGATAACAGTAAATCAAATAAGATATTTGT
CGGTGGAATTCCTCACAATTGTGGTGAGACAGAGCTCAGGGAATACTTCAAGAAGTTCGGAGTGGTCACG
GAGGTAGTCATGATCTATGACGCCGAGAAGCAGAGGCCCCGAGGTTTTGGATTTATTACTTTCGAGGACG
AACAATCAGTGGACCAGGCTGTCAACATGCATTTTCACGACATCATGGGCAAAAAAGTGGAAGTTAAACG
AGCTGAGCCTCGGGACAGCAAGAGCCAAGCGCCGGGACAGCCAGGTGCCAGCCAGTGGGGGAGCCGGGTT
GTGCCCAACGCTGCCAATGGCTGGGCAGGCCAGCCCCCGCCCACGTGGCAGCAAGGATATGGCCCGCAAG
GAATGTGGGTGCCGGCAGGACAGGCGATTGGTGGCTATGGACCGCCCCCTGCAGGAAGAGGAGCCCCCCC
GCCACCCCCACCGTTCACCTCCTACATCGTGTCCACCCCTCCTGGAGGCTTTCCCCCTCCCCAGGGCTTC
CCTCAGGGCTACGGTGCCCCGCCACAGTTCAGTTTTGGCTACGGGCCTCCACCTCCACCGCCAGATCAGT
TTGCCCCTCCGGGGGTTCCTCCTCCACCAGCCACTCCCGGGGCAGCACCTCTGGCTTTCCCACCGCCTCC
GTCTCAGGCTGCCCCGGACATGAGCAAGCCCCCGACAGCTCAGCCAGACTTCCCCTATGGTCAGTATGGC
CTGGGTTCCTATTCTCCAGCCCCGCCGGGCTGCGGCCCACACTTTGTTTACAGTCTTATGGTCAGGCTGA
GCAGTGATGTGGCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_170711
ORF Size 1137 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_170711.2, NP_733829.1
RefSeq Size 2304
RefSeq ORF 1137
Locus ID 26528
Protein Families Stem cell - Pluripotency
Gene Summary In mammals, the Y chromosome directs the development of the testes and plays an important role in spermatogenesis. A high percentage of infertile men have deletions that map to regions of the Y chromosome. The DAZ (deleted in azoospermia) gene cluster maps to the AZFc region of the Y chromosome and is deleted in many azoospermic and severely oligospermic men. It is thought that the DAZ gene cluster arose from the transposition, amplification, and pruning of the ancestral autosomal gene DAZL also involved in germ cell development and gametogenesis. This gene encodes a RNA-binding protein with two RNP motifs that was originally identified by its interaction with the infertility factors DAZ and DAZL. Two isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the shorter isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.