TIA1 (NM_022173) Human Untagged Clone
CAT#: SC313245
TIA1 (untagged)-Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2
"NM_022173" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TIA1 |
Synonyms | TIA-1; WDM |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_022173, the custom clone sequence may differ by one or more nucleotides
ATGGAGGACGAGATGCCCAAGACTCTATACGTCGGTAACCTTTCCAGAGATGTGACAGAAGCTCTAATTC TGCAACTCTTTAGCCAGATTGGACCTTGTAAAAACTGCAAAATGATTATGGATACAGCTGGAAATGATCC CTATTGTTTTGTGGAGTTTCATGAGCATCGTCATGCAGCTGCAGCATTAGCTGCTATGAATGGACGGAAG ATAATGGGTAAGGAAGTCAAAGTGAATTGGGCAACAACCCCTAGCAGTCAAAAGAAAGATACAAGCAGTA GTACCGTTGTCAGCACACAGCGTTCACAAGATCATTTCCATGTCTTTGTTGGTGATCTCAGCCCAGAAAT TACAACTGAAGATATAAAAGCTGCTTTTGCACCATTTGGAAGAATATCAGATGCCCGAGTGGTAAAAGAC ATGGCAACAGGAAAGTCTAAGGGATATGGCTTTGTCTCCTTTTTCAACAAATGGGATGCTGAAAACGCCA TTCAACAGATGGGTGGCCAGTGGCTTGGTGGAAGACAAATCAGAACTAACTGGGCAACCCGAAAGCCTCC CGCTCCAAAGAGTACATATGAGTCAAATACCAAACAGCTATCATATGATGAGGTTGTAAATCAGTCTAGT CCAAGCAACTGTACTGTATACTGTGGAGGTGTTACTTCTGGGCTAACAGAACAACTAATGCGTCAGACTT TTTCACCATTTGGACAAATAATGGAAATTCGAGTCTTTCCAGATAAAGGATATTCATTTGTTCGGTTCAA TTCCCATGAAAGTGCAGCACATGCAATTGTTTCTGTTAATGGTACTACCATTGAAGGTCATGTTGTGAAA TGCTATTGGGGCAAAGAAACTCTTGATATGATAAATCCCGTGCAACAGCAGAATCAAATTGGATATCCCC AACCTTATGGCCAGTGGGGCCAGTGGTATGGAAATGCACAACAAATTGGCCAGTATATGCCTAATGGTTG GCAAGTTCCTGCATATGGAATGTATGGCCAGGCATGGAACCAGCAAGGATTTAATCAGACACAGTCTTCT GCACCATGGATGGGACCAAATTATGGAGTGCAACCGCCTCAAGGGCAAAATGGCAGCATGTTGCCCAATC AGCCTTCTGGGTATCGAGTGGCAGGGTATGAAACCCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_022173 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_022173.2, NP_071505.2 |
RefSeq Size | 4653 bp |
RefSeq ORF | 1161 bp |
Locus ID | 7072 |
Cytogenetics | 2p13.3 |
Domains | RRM, RRM_1 |
Protein Families | Druggable Genome |
Gene Summary | 'The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms has been found for this gene. [provided by RefSeq, May 2017]' Transcript Variant: This variant (2) includes exon 5, which is missing in transcript variant 1, resulting in the longer isoform (2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219386 | TIA1 (Myc-DDK-tagged)-Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2 |
USD 420.00 |
|
RG219386 | TIA1 (GFP-tagged) - Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2 |
USD 460.00 |
|
RC219386L1 | Lenti ORF clone of Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC219386L2 | Lenti ORF clone of Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC219386L3 | Lenti ORF clone of Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC219386L4 | Lenti ORF clone of Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review