Signal Peptide Peptidase (HM13) (NM_178580) Human Untagged Clone

CAT#: SC313282

HM13 (untagged)-Human histocompatibility (minor) 13 (HM13), transcript variant 2


  "NM_178580" in other vectors (4)

Reconstitution Protocol

USD 670.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HM13"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HM13
Synonyms H13; IMP1; IMPAS; IMPAS-1; MSTP086; PSENL3; PSL3; SPP; SPPL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_178580, the custom clone sequence may differ by one or more nucleotides


ATGGACTCGGCCCTCAGCGATCCGCATAACGGCAGTGCCGAGGCAGGCGGCCCCACCAACAGCACTACGC
GGCCGCCTTCCACGCCCGAGGGCATCGCGCTGGCCTACGGCAGCCTCCTGCTCATGGCGCTGCTGCCCAT
CTTCTTCGGCGCCCTGCGCTCCGTACGCTGCGCCCGCGGCAAGAATGCTTCAGACATGCCTGAAACAATC
ACCAGCCGGGATGCCGCCCGCTTCCCCATCATCGCCAGCTGCACACTCTTGGGGCTCTACCTCTTTTTCA
AAATATTCTCCCAGGAGTACATCAACCTCCTGCTGTCCATGTATTTCTTCGTGCTGGGAATCCTGGCCCT
GTCCCACACCATCAGCCCCTTCATGAATAAGTTTTTTCCAGCCAGCTTTCCAAATCGACAGTACCAGCTG
CTCTTCACACAGGGTTCTGGGGAAAACAAGGAAGAGATCATCAATTATGAATTTGACACCAAGGACCTGG
TGTGCCTGGGCCTGAGCAGCATCGTTGGCGTCTGGTACCTGCTGAGGAAGCACTGGATTGCCAACAACCT
TTTTGGCCTGGCCTTCTCCCTTAATGGAGTAGAGCTCCTGCACCTCAACAATGTCAGCACTGGCTGCATC
CTGCTGGGCGGACTCTTCATCTACGATGTCTTCTGGGTATTTGGCACCAATGTGATGGTGACAGTGGCCA
AGTCCTTCGAGGCACCAATAAAATTGGTGTTTCCCCAGGATCTGCTGGAGAAAGGCCTCGAAGCAAACAA
CTTTGCCATGCTGGGACTTGGAGATGTCGTCATTCCAGGGATCTTCATTGCCTTGCTGCTGCGCTTTGAC
ATCAGCTTGAAGAAGAATACCCACACCTACTTCTACACCAGCTTTGCAGCCTACATCTTCGGCCTGGGCC
TTACCATCTTCATCATGCACATCTTCAAGCATGCTCAGCCTGCCCTCCTATACCTGGTCCCCGCCTGCAT
CGGTTTTCCTGTCCTGGTGGCGCTGGCCAAGGGAGAAGTGACAGAGATGTTCAGCTACGAGTCCTCGGCG
GAAATCCTGCCTCATACCCCGAGGCTCACCCACTTCCCCACAGTCTCGGGCTCCCCAGCCAGCCTGGCCG
ACTCCATGCAGCAGAAGCTAGCTGGCCCTCGCCGCCGGCGCCCGCAGAATCCCAGCGCCATGTAA


Restriction Sites SgfI-MluI     
ACCN NM_178580
ORF Size 1185 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_178580.2, NP_848695.1
RefSeq Size 1827
RefSeq ORF 1185
Locus ID 81502
Protein Families Protease, Transmembrane
Gene Summary The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) contains an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (2) is longer and has a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.