Cytohesin 1 (CYTH1) (NM_017456) Human Untagged Clone

CAT#: SC313294

CYTH1 (untagged)-Human cytohesin 1 (CYTH1), transcript variant 2


  "NM_017456" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CYTH1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CYTH1
Synonyms B2-1; CYTOHESIN-1; D17S811E; PSCD1; SEC7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_017456, the custom clone sequence may differ by one or more nucleotides


ATGGAGGAGGACGACAGCTACGTTCCCAGTGACCTGACAGCAGAGGAGCGTCAAGAACTGGAGAACATCC
GACGGAGAAAACAGGAGCTGCTGGCTGACATTCAGAGGCTGAAGGATGAGATAGCAGAAGTAGCTAATGA
AATTGAAAACCTGGGATCCACAGAGGAAAGGAAAAACATGCAGAGGAACAAACAGGTAGCCATGGGCAGG
AAAAAATTTAATATGGACCCTAAAAAGGGGATCCAGTTCTTAATAGAGAACGACCTCCTGAAGAACACTT
GTGAAGACATTGCCCAGTTCTTATATAAAGGCGAAGGGCTCAACAAGACAGCCATCGGCGACTACCTAGG
GGAGAGAGATGAGTTTAATATCCAGGTTCTTCATGCATTTGTGGAGCTGCATGAGTTCACTGATCTTAAT
CTCGTCCAGGCACTACGGCAGTTCCTGTGGAGCTTCCGGCTACCCGGAGAGGCCCAGAAGATCGACCGGA
TGATGGAGGCGTTTGCCCAGCGATATTGTCAGTGCAATAATGGCGTGTTCCAGTCCACGGATACTTGTTA
CGTCCTCTCCTTTGCCATCATCATGTTGAACACCAGTCTGCACAACCCCAATGTCAAAGATAAGCCCACT
GTGGAGAGGTTCATTGCCATGAACCGAGGCATCAATGATGGGGGAGACCTGCCGGAGGAGCTCCTCCGGA
ATCTCTATGAGAGCATAAAAAATGAACCCTTTAAAATCCCAGAAGACGACGGGAATGACCTCACTCACAC
TTTCTTCAATCCAGACCGAGAAGGCTGGCTATTGAAACTCGGTGGCAGGGTAAAGACTTGGAAGAGACGC
TGGTTCATTCTGACTGACAACTGCCTTTACTACTTTGAGTATACCACGGATAAGGAGCCCCGTGGAATCA
TCCCTTTAGAGAATCTGAGTATCCGGGAAGTGGAGGACTCCAAAAAACCAAACTGCTTTGAGCTTTATAT
CCCCGACAATAAAGACCAAGTTATCAAGGCCTGCAAGACCGAGGCTGACGGGCGGGTGGTGGAGGGGAAC
CACACTGTTTACCGGATCTCAGCTCCGACGCCCGAGGAGAAGGAGGAGTGGATTAAGTGCATTAAAGCAG
CCATCAGCAGGGACCCTTTCTACGAAATGCTCGCAGCACGGAAAAAGAAGGTCTCCTCCACGAAGCGACA
CTGA


Restriction Sites SgfI-MluI     
ACCN NM_017456
ORF Size 1194 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_017456.3, NP_059430.2
RefSeq Size 3363
RefSeq ORF 1194
Locus ID 9267
Domains Sec7, PH
Gene Summary The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.